ID: 1089993491

View in Genome Browser
Species Human (GRCh38)
Location 11:122883084-122883106
Sequence GGAGCCGGCGCGGGAGCCTT CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 200
Summary {0: 1, 1: 0, 2: 4, 3: 20, 4: 175}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089993486_1089993491 -6 Left 1089993486 11:122883067-122883089 CCCAAGCAAGCTGGGGAGGAGCC 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1089993491 11:122883084-122883106 GGAGCCGGCGCGGGAGCCTTCGG 0: 1
1: 0
2: 4
3: 20
4: 175
1089993485_1089993491 -3 Left 1089993485 11:122883064-122883086 CCACCCAAGCAAGCTGGGGAGGA 0: 1
1: 0
2: 7
3: 10
4: 231
Right 1089993491 11:122883084-122883106 GGAGCCGGCGCGGGAGCCTTCGG 0: 1
1: 0
2: 4
3: 20
4: 175
1089993487_1089993491 -7 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993491 11:122883084-122883106 GGAGCCGGCGCGGGAGCCTTCGG 0: 1
1: 0
2: 4
3: 20
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089993491 Original CRISPR GGAGCCGGCGCGGGAGCCTT CGG Intronic