ID: 1089993493

View in Genome Browser
Species Human (GRCh38)
Location 11:122883088-122883110
Sequence CGTCCCGAAGGCTCCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 42}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089993493_1089993499 -5 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993499 11:122883106-122883128 GGACGGAGTGGGGAGCGACAAGG 0: 1
1: 0
2: 0
3: 20
4: 270
1089993493_1089993501 -3 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993501 11:122883108-122883130 ACGGAGTGGGGAGCGACAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 137
1089993493_1089993508 21 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993508 11:122883132-122883154 CGAGGCCGCGACAAGGGGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1089993493_1089993511 24 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993511 11:122883135-122883157 GGCCGCGACAAGGGGCTGGGGGG 0: 1
1: 0
2: 0
3: 15
4: 235
1089993493_1089993500 -4 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993500 11:122883107-122883129 GACGGAGTGGGGAGCGACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 133
1089993493_1089993510 23 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993510 11:122883134-122883156 AGGCCGCGACAAGGGGCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 165
1089993493_1089993507 20 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993507 11:122883131-122883153 GCGAGGCCGCGACAAGGGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 132
1089993493_1089993505 15 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993505 11:122883126-122883148 AGGGGGCGAGGCCGCGACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 96
1089993493_1089993504 14 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993504 11:122883125-122883147 AAGGGGGCGAGGCCGCGACAAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1089993493_1089993509 22 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993509 11:122883133-122883155 GAGGCCGCGACAAGGGGCTGGGG 0: 1
1: 0
2: 0
3: 30
4: 216
1089993493_1089993502 -2 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993502 11:122883109-122883131 CGGAGTGGGGAGCGACAAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1089993493_1089993506 16 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993506 11:122883127-122883149 GGGGGCGAGGCCGCGACAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 145
1089993493_1089993503 3 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993503 11:122883114-122883136 TGGGGAGCGACAAGGGGGCGAGG 0: 1
1: 0
2: 0
3: 21
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089993493 Original CRISPR CGTCCCGAAGGCTCCCGCGC CGG (reversed) Intronic
900963109 1:5938203-5938225 CTTCCCGATGGCTCGCTCGCTGG + Intronic
907270529 1:53288386-53288408 CGTCCTGAAGGCTCCCAGGCAGG - Intronic
908315464 1:62927975-62927997 CTTCCCGAAAGCTCCAGAGCGGG - Intergenic
911002534 1:93180703-93180725 CGTCCCAACGGCTCCCGCGGCGG + Exonic
924801460 1:247331830-247331852 CGTCCGGCGGGCTCCCGCGGCGG - Intronic
1072631390 10:97149245-97149267 CTTCCCGGAGACTCCCGTGCCGG + Intronic
1075587011 10:123665688-123665710 AGCCCCGAAGGCTCCGGTGCAGG - Intergenic
1081488275 11:43547941-43547963 CGCCCCGAGAGCTCCCGCGCGGG - Intergenic
1089993493 11:122883088-122883110 CGTCCCGAAGGCTCCCGCGCCGG - Intronic
1096259420 12:50081547-50081569 GGCCCCGAAGGCTCTCGCACGGG - Exonic
1098288629 12:68933632-68933654 CGTCCCGCAGGAGCCCGCGCGGG - Intronic
1118641431 14:67796326-67796348 CGTGCCTCAGGCTCCCGAGCTGG + Intronic
1119673425 14:76536878-76536900 AGTCCCGAGGGCTGCCCCGCGGG + Intergenic
1121107219 14:91289040-91289062 TGTCCTGAAGGGTCCCGCACCGG - Intronic
1130201114 15:81827731-81827753 CATCCAGAAGGGTCCCGAGCAGG + Intergenic
1130938888 15:88491495-88491517 CGTGCCTAAGGGTCCCGAGCAGG + Intergenic
1148550949 17:48550601-48550623 CGTCCCGTAGGCGCCCCCGTTGG + Exonic
1152354103 17:79798294-79798316 CGTCCCCCAGCTTCCCGCGCTGG - Intronic
1152677812 17:81650743-81650765 GGTCCAGCAGGCTCCCGGGCTGG + Exonic
1152728776 17:81960088-81960110 CGGCAGGAAGGCTCCCCCGCCGG - Intronic
1153052151 18:909343-909365 CTCCCCGAAGGCTCCCGCGTGGG + Intronic
1155130841 18:22933334-22933356 CGTCGCGCGGGCTCCCGGGCGGG + Intronic
1161955060 19:7489083-7489105 CGCCCCAAAGGCTTGCGCGCAGG + Intronic
1167265371 19:48480463-48480485 CGGCCTGAAGGCCCCCGCGGTGG + Intronic
1167743637 19:51339004-51339026 CTCCCCGAAGGCATCCGCGCCGG - Exonic
925744822 2:7034845-7034867 ACTCCCGAAGGCTCCCCAGCCGG - Intronic
926397014 2:12453917-12453939 CCTCCCCGAGGCTCCCCCGCCGG - Intergenic
938537226 2:132256737-132256759 GGTCCCGAAGGCGCACGCCCGGG + Intronic
945241578 2:207681529-207681551 CGTCCCGGAGGCGGCGGCGCAGG + Intergenic
948953967 2:241272805-241272827 CGTCCCGGCTTCTCCCGCGCGGG - Exonic
1177157454 21:17513356-17513378 CGTCCCGTAGGGAGCCGCGCAGG + Intronic
1180054906 21:45352697-45352719 AGTCCCGAGGGCTCCTGCGGCGG + Intergenic
1180312843 22:11253390-11253412 GGTCCCGAAGGCGCACGCCCGGG + Intergenic
1185291452 22:50029812-50029834 CGTCCTGAAGACCCCCACGCGGG + Intronic
961698856 3:128726303-128726325 CGTCGCGAGGGCTCCCGCCGAGG - Exonic
968472024 4:786727-786749 GGTCCCGGCGGCTCCCGGGCGGG + Intronic
969622461 4:8285597-8285619 GGTCCCGAAGGTTCCCACCCTGG + Intronic
1002421043 5:179149169-179149191 CTTCCCGAAGGCCCCCACACTGG - Intronic
1002887890 6:1312265-1312287 TGCCCCGAAGACGCCCGCGCGGG + Intergenic
1003556037 6:7141139-7141161 CGCCCCCAGGGCTCCCGCGGTGG + Intronic
1005758867 6:28949919-28949941 AGTCCCGAAGCCTGCCCCGCGGG + Intergenic
1007600152 6:43076331-43076353 CGTCCCGAGGCGTCCCGAGCCGG - Intronic
1018424947 6:163671619-163671641 CGTCCCCAAAGCTCCCGCGCAGG - Intergenic
1023016344 7:35971606-35971628 CCTCCCGAAGGCGGCGGCGCAGG - Intergenic
1034957733 7:155344968-155344990 CGCCCCAAAGCTTCCCGCGCGGG + Intergenic
1051780557 9:20684332-20684354 CGACCCGGCGGCTCCCGAGCAGG - Intronic
1061003933 9:127917720-127917742 CCTCTCGAAGGCTCCCTCGCTGG + Intergenic
1062249315 9:135586333-135586355 CCTCCCGGAGGCTCCAGGGCAGG - Intergenic
1192118609 X:68433989-68434011 CCTGCCGCAGGCTCCTGCGCAGG + Intergenic
1195273057 X:103252300-103252322 CTTCCTGAAGGCTCCTGGGCAGG - Intergenic