ID: 1089993493

View in Genome Browser
Species Human (GRCh38)
Location 11:122883088-122883110
Sequence CGTCCCGAAGGCTCCCGCGC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 50
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 42}

Found 13 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089993493_1089993506 16 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993506 11:122883127-122883149 GGGGGCGAGGCCGCGACAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 145
1089993493_1089993501 -3 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993501 11:122883108-122883130 ACGGAGTGGGGAGCGACAAGGGG 0: 1
1: 0
2: 0
3: 6
4: 137
1089993493_1089993503 3 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993503 11:122883114-122883136 TGGGGAGCGACAAGGGGGCGAGG 0: 1
1: 0
2: 0
3: 21
4: 284
1089993493_1089993499 -5 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993499 11:122883106-122883128 GGACGGAGTGGGGAGCGACAAGG 0: 1
1: 0
2: 0
3: 20
4: 270
1089993493_1089993509 22 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993509 11:122883133-122883155 GAGGCCGCGACAAGGGGCTGGGG 0: 1
1: 0
2: 0
3: 30
4: 216
1089993493_1089993507 20 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993507 11:122883131-122883153 GCGAGGCCGCGACAAGGGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 132
1089993493_1089993500 -4 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993500 11:122883107-122883129 GACGGAGTGGGGAGCGACAAGGG 0: 1
1: 0
2: 0
3: 8
4: 133
1089993493_1089993508 21 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993508 11:122883132-122883154 CGAGGCCGCGACAAGGGGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 83
1089993493_1089993504 14 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993504 11:122883125-122883147 AAGGGGGCGAGGCCGCGACAAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1089993493_1089993511 24 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993511 11:122883135-122883157 GGCCGCGACAAGGGGCTGGGGGG 0: 1
1: 0
2: 0
3: 15
4: 235
1089993493_1089993502 -2 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993502 11:122883109-122883131 CGGAGTGGGGAGCGACAAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1089993493_1089993510 23 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993510 11:122883134-122883156 AGGCCGCGACAAGGGGCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 165
1089993493_1089993505 15 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993505 11:122883126-122883148 AGGGGGCGAGGCCGCGACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 96

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089993493 Original CRISPR CGTCCCGAAGGCTCCCGCGC CGG (reversed) Intronic