ID: 1089993494

View in Genome Browser
Species Human (GRCh38)
Location 11:122883089-122883111
Sequence CGGCGCGGGAGCCTTCGGGA CGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 110
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 101}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089993487_1089993494 -2 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993494 11:122883089-122883111 CGGCGCGGGAGCCTTCGGGACGG 0: 1
1: 0
2: 0
3: 8
4: 101
1089993486_1089993494 -1 Left 1089993486 11:122883067-122883089 CCCAAGCAAGCTGGGGAGGAGCC 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1089993494 11:122883089-122883111 CGGCGCGGGAGCCTTCGGGACGG 0: 1
1: 0
2: 0
3: 8
4: 101
1089993485_1089993494 2 Left 1089993485 11:122883064-122883086 CCACCCAAGCAAGCTGGGGAGGA 0: 1
1: 0
2: 7
3: 10
4: 231
Right 1089993494 11:122883089-122883111 CGGCGCGGGAGCCTTCGGGACGG 0: 1
1: 0
2: 0
3: 8
4: 101

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089993494 Original CRISPR CGGCGCGGGAGCCTTCGGGA CGG Intronic