ID: 1089993498

View in Genome Browser
Species Human (GRCh38)
Location 11:122883100-122883122
Sequence CGCTCCCCACTCCGTCCCGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 1, 3: 11, 4: 64}

Found 10 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089993498_1089993503 -9 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993503 11:122883114-122883136 TGGGGAGCGACAAGGGGGCGAGG 0: 1
1: 0
2: 0
3: 21
4: 284
1089993498_1089993505 3 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993505 11:122883126-122883148 AGGGGGCGAGGCCGCGACAAGGG 0: 1
1: 0
2: 0
3: 5
4: 96
1089993498_1089993506 4 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993506 11:122883127-122883149 GGGGGCGAGGCCGCGACAAGGGG 0: 1
1: 0
2: 0
3: 4
4: 145
1089993498_1089993509 10 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993509 11:122883133-122883155 GAGGCCGCGACAAGGGGCTGGGG 0: 1
1: 0
2: 0
3: 30
4: 216
1089993498_1089993511 12 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993511 11:122883135-122883157 GGCCGCGACAAGGGGCTGGGGGG 0: 1
1: 0
2: 0
3: 15
4: 235
1089993498_1089993510 11 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993510 11:122883134-122883156 AGGCCGCGACAAGGGGCTGGGGG 0: 1
1: 0
2: 0
3: 13
4: 165
1089993498_1089993513 25 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993513 11:122883148-122883170 GGCTGGGGGGCCGCCATGCGAGG 0: 1
1: 0
2: 0
3: 18
4: 184
1089993498_1089993507 8 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993507 11:122883131-122883153 GCGAGGCCGCGACAAGGGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 132
1089993498_1089993504 2 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993504 11:122883125-122883147 AAGGGGGCGAGGCCGCGACAAGG 0: 1
1: 0
2: 0
3: 8
4: 94
1089993498_1089993508 9 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993508 11:122883132-122883154 CGAGGCCGCGACAAGGGGCTGGG 0: 1
1: 0
2: 0
3: 2
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089993498 Original CRISPR CGCTCCCCACTCCGTCCCGA AGG (reversed) Intronic