ID: 1089993502

View in Genome Browser
Species Human (GRCh38)
Location 11:122883109-122883131
Sequence CGGAGTGGGGAGCGACAAGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 196
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 180}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089993487_1089993502 18 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993502 11:122883109-122883131 CGGAGTGGGGAGCGACAAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1089993485_1089993502 22 Left 1089993485 11:122883064-122883086 CCACCCAAGCAAGCTGGGGAGGA 0: 1
1: 0
2: 7
3: 10
4: 231
Right 1089993502 11:122883109-122883131 CGGAGTGGGGAGCGACAAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1089993493_1089993502 -2 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993502 11:122883109-122883131 CGGAGTGGGGAGCGACAAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 180
1089993486_1089993502 19 Left 1089993486 11:122883067-122883089 CCCAAGCAAGCTGGGGAGGAGCC 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1089993502 11:122883109-122883131 CGGAGTGGGGAGCGACAAGGGGG 0: 1
1: 0
2: 0
3: 15
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089993502 Original CRISPR CGGAGTGGGGAGCGACAAGG GGG Intronic