ID: 1089993503

View in Genome Browser
Species Human (GRCh38)
Location 11:122883114-122883136
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 306
Summary {0: 1, 1: 0, 2: 0, 3: 21, 4: 284}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089993498_1089993503 -9 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993503 11:122883114-122883136 TGGGGAGCGACAAGGGGGCGAGG 0: 1
1: 0
2: 0
3: 21
4: 284
1089993485_1089993503 27 Left 1089993485 11:122883064-122883086 CCACCCAAGCAAGCTGGGGAGGA 0: 1
1: 0
2: 7
3: 10
4: 231
Right 1089993503 11:122883114-122883136 TGGGGAGCGACAAGGGGGCGAGG 0: 1
1: 0
2: 0
3: 21
4: 284
1089993486_1089993503 24 Left 1089993486 11:122883067-122883089 CCCAAGCAAGCTGGGGAGGAGCC 0: 1
1: 0
2: 2
3: 19
4: 218
Right 1089993503 11:122883114-122883136 TGGGGAGCGACAAGGGGGCGAGG 0: 1
1: 0
2: 0
3: 21
4: 284
1089993493_1089993503 3 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993503 11:122883114-122883136 TGGGGAGCGACAAGGGGGCGAGG 0: 1
1: 0
2: 0
3: 21
4: 284
1089993487_1089993503 23 Left 1089993487 11:122883068-122883090 CCAAGCAAGCTGGGGAGGAGCCG 0: 1
1: 0
2: 1
3: 11
4: 196
Right 1089993503 11:122883114-122883136 TGGGGAGCGACAAGGGGGCGAGG 0: 1
1: 0
2: 0
3: 21
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type