ID: 1089993507

View in Genome Browser
Species Human (GRCh38)
Location 11:122883131-122883153
Sequence GCGAGGCCGCGACAAGGGGC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 150
Summary {0: 1, 1: 0, 2: 0, 3: 17, 4: 132}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089993493_1089993507 20 Left 1089993493 11:122883088-122883110 CCGGCGCGGGAGCCTTCGGGACG 0: 1
1: 0
2: 1
3: 6
4: 42
Right 1089993507 11:122883131-122883153 GCGAGGCCGCGACAAGGGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 132
1089993498_1089993507 8 Left 1089993498 11:122883100-122883122 CCTTCGGGACGGAGTGGGGAGCG 0: 1
1: 0
2: 1
3: 11
4: 64
Right 1089993507 11:122883131-122883153 GCGAGGCCGCGACAAGGGGCTGG 0: 1
1: 0
2: 0
3: 17
4: 132

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089993507 Original CRISPR GCGAGGCCGCGACAAGGGGC TGG Intronic