ID: 1089993508 |
View in Genome Browser |
Species | Human (GRCh38) |
Location | 11:122883132-122883154 |
Sequence | CGAGGCCGCGACAAGGGGCT GGG |
Strand | + |
Crispr in exon? | No |
Crispr in intron? | Yes |
Off-Target Counts | All | Exonic | Intronic | Intergenic |
---|---|---|---|---|
Total | 86 | |||
Summary | {0: 1, 1: 0, 2: 0, 3: 2, 4: 83} |
Found 2 Related Crispr Pairs
Show Crispr PairsID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
---|---|---|---|---|---|---|---|---|
1089993493_1089993508 | 21 | Left | 1089993493 | 11:122883088-122883110 | CCGGCGCGGGAGCCTTCGGGACG | 0: 1 1: 0 2: 1 3: 6 4: 42 |
||
Right | 1089993508 | 11:122883132-122883154 | CGAGGCCGCGACAAGGGGCTGGG | 0: 1 1: 0 2: 0 3: 2 4: 83 |
||||
1089993498_1089993508 | 9 | Left | 1089993498 | 11:122883100-122883122 | CCTTCGGGACGGAGTGGGGAGCG | 0: 1 1: 0 2: 1 3: 11 4: 64 |
||
Right | 1089993508 | 11:122883132-122883154 | CGAGGCCGCGACAAGGGGCTGGG | 0: 1 1: 0 2: 0 3: 2 4: 83 |
Note: the row highlighted in blue is the original CRISPR
WGE ID | Location | Sequence | Mismatches | Strand | Type |
---|---|---|---|---|---|
1089993508 | Original CRISPR | CGAGGCCGCGACAAGGGGCT GGG | Intronic | ||