ID: 1089993510 |
View in Genome Browser |
| Species | Human (GRCh38) |
| Location | 11:122883134-122883156 |
| Sequence | AGGCCGCGACAAGGGGCTGG GGG |
| Strand | + |
| Crispr in exon? | No |
| Crispr in intron? | Yes |
| Off-Target Counts | All | Exonic | Intronic | Intergenic |
|---|---|---|---|---|
| Total | 179 | |||
| Summary | {0: 1, 1: 0, 2: 0, 3: 13, 4: 165} |
Found 2 Related Crispr Pairs
Show Crispr Pairs| ID | Spacer | Status | Summary | ID | Location | Sequence | Summary | |
|---|---|---|---|---|---|---|---|---|
| 1089993498_1089993510 | 11 | Left | 1089993498 | 11:122883100-122883122 | CCTTCGGGACGGAGTGGGGAGCG | 0: 1 1: 0 2: 1 3: 11 4: 64 |
||
| Right | 1089993510 | 11:122883134-122883156 | AGGCCGCGACAAGGGGCTGGGGG | 0: 1 1: 0 2: 0 3: 13 4: 165 |
||||
| 1089993493_1089993510 | 23 | Left | 1089993493 | 11:122883088-122883110 | CCGGCGCGGGAGCCTTCGGGACG | 0: 1 1: 0 2: 1 3: 6 4: 42 |
||
| Right | 1089993510 | 11:122883134-122883156 | AGGCCGCGACAAGGGGCTGGGGG | 0: 1 1: 0 2: 0 3: 13 4: 165 |
Note: the row highlighted in blue is the original CRISPR
| WGE ID | Location | Sequence | Mismatches | Strand | Type |
|---|---|---|---|---|---|
| 1089993510 | Original CRISPR | AGGCCGCGACAAGGGGCTGG GGG | Intronic | ||