ID: 1089995700

View in Genome Browser
Species Human (GRCh38)
Location 11:122905150-122905172
Sequence AATGCCTTCTCTTCCTCATC AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 302
Summary {0: 1, 1: 0, 2: 2, 3: 32, 4: 267}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089995700 Original CRISPR AATGCCTTCTCTTCCTCATC AGG Intronic
900121651 1:1050871-1050893 GCTGCCTGCTCTTCCTCCTCGGG + Intronic
900982632 1:6055122-6055144 AATGTCTTCTCTCCCACTTCTGG - Intronic
901117317 1:6857651-6857673 AATGCCTTCTCTTCCCTCTATGG - Intronic
901863173 1:12087713-12087735 ACTTCCTTCTCATCCTCTTCTGG + Intronic
903374814 1:22859223-22859245 AATGCCTTCCCTTCACCATCAGG - Intronic
904400549 1:30253900-30253922 ACTGCCTCCTCCTCATCATCAGG - Intergenic
905916847 1:41690426-41690448 AATGCCTTCTCTGAGTCCTCAGG + Intronic
906088560 1:43157357-43157379 AATACCATCTCTTCCTCATGGGG + Intergenic
908250776 1:62264016-62264038 AATAGCTTCTCTTCCCCATTAGG - Intronic
909541706 1:76799008-76799030 AGTGGCTCCTCTTCTTCATCAGG - Intergenic
913025462 1:114833545-114833567 TATGCCTTGCCTTCTTCATCTGG - Intergenic
915570762 1:156744004-156744026 AATGCCTTCTGTGTCCCATCTGG + Intronic
916288921 1:163141959-163141981 AATCCTTTCTCTTCCTCCCCTGG - Intronic
916465759 1:165073285-165073307 ACTGCCTTATCTTCCTGGTCTGG - Intergenic
918122054 1:181548867-181548889 AATCCCATCTCTTCATTATCTGG - Intronic
918332226 1:183471844-183471866 ATTGTCTTCTCTTCCTCTCCGGG + Intergenic
918552152 1:185755720-185755742 AATCCCTTCTCACTCTCATCAGG - Intronic
920451225 1:206062616-206062638 TATGCCTCCTCCTCCACATCTGG - Intronic
920693229 1:208162745-208162767 AATGCCTTACTTTCTTCATCAGG - Intronic
920749988 1:208664805-208664827 AATGCCTTCTCTTCTAAATATGG - Intergenic
920750176 1:208666894-208666916 GATGACTTCTCCACCTCATCAGG - Intergenic
921340356 1:214128432-214128454 GATGCCTTCCCTCACTCATCTGG - Intergenic
922213770 1:223504817-223504839 AGTGCCTTCTCCAACTCATCTGG + Intergenic
922793604 1:228324823-228324845 AATGCCTCAGCCTCCTCATCTGG + Intronic
923584862 1:235259514-235259536 AAGGCTTTCTCTTCCTCTACAGG + Intronic
1064479688 10:15726841-15726863 AATTCCTTGTCTTCCAGATCTGG - Intergenic
1064565805 10:16637674-16637696 AATGGCTTCTCTTCATAATGGGG - Intronic
1065643763 10:27813317-27813339 AAGGCCATTTATTCCTCATCAGG + Intronic
1066024959 10:31347153-31347175 AATTCATTTTCTTCCTCATAGGG - Intronic
1066277094 10:33879935-33879957 CATGCCTTTTCATCATCATCAGG - Intergenic
1066294367 10:34041417-34041439 AATGCATTCTCTTACAGATCTGG - Intergenic
1067320511 10:45216148-45216170 AACTCCTTCTATGCCTCATCTGG - Intergenic
1068601129 10:58957792-58957814 CATGCCTGATCTTCCTCTTCTGG + Intergenic
1069073572 10:64014897-64014919 ACTGCCTTCTGCTCCACATCTGG - Intergenic
1071007340 10:80897537-80897559 AATGCTGTCTCTTCTTTATCAGG + Intergenic
1071343632 10:84670763-84670785 AATTCTTTTTCTTTCTCATCCGG - Intergenic
1071521186 10:86332298-86332320 AATGCATCCTCTTCCTCTCCAGG - Intronic
1073295160 10:102434459-102434481 ATTGCTTTCTCTTCCACCTCTGG + Intergenic
1074799556 10:116985875-116985897 AATGACTTCTCTTTCTACTCTGG - Intronic
1075668170 10:124245310-124245332 GCGGTCTTCTCTTCCTCATCAGG + Intergenic
1075941920 10:126397061-126397083 GATGCCTTCTCTACCTCTTCAGG + Intergenic
1077727554 11:4690559-4690581 CATGTCTTCACCTCCTCATCTGG + Intronic
1078318409 11:10310709-10310731 AAGGCCTTCTCCTTCTCAGCTGG - Intronic
1078948167 11:16095249-16095271 AATTCCTTTTCTGCCTCACCGGG - Intronic
1079910153 11:26299768-26299790 AAGGCCATCTCTTCCACATATGG - Intergenic
1082217634 11:49593652-49593674 TGTGCCTTCATTTCCTCATCTGG - Intergenic
1085783469 11:79430471-79430493 GATGCCTACTCTCCCTCTTCTGG + Intronic
1086017687 11:82186762-82186784 AATGTATTCTCTTTCTCATAGGG - Intergenic
1086172604 11:83852797-83852819 AATTCCTTCTTTTCTTTATCAGG + Intronic
1086631942 11:89030498-89030520 TGTGCCTTCATTTCCTCATCTGG + Intronic
1088531823 11:110818966-110818988 AATGCCTTCTCTACAGCATCTGG - Intergenic
1088600035 11:111465763-111465785 AAAGCCTTCTCTTGCTTCTCTGG - Intergenic
1088902109 11:114126220-114126242 AATGCCAGCTCTGCCCCATCTGG + Intronic
1089995700 11:122905150-122905172 AATGCCTTCTCTTCCTCATCAGG + Intronic
1090032652 11:123220327-123220349 ATTGCCTTCCCTACTTCATCAGG + Intergenic
1090344808 11:126061822-126061844 AATGCCTGCCCTTCCTCATCAGG - Intronic
1091177123 11:133570511-133570533 CATGTCCTCTCTTCCACATCAGG + Intergenic
1092547054 12:9461302-9461324 ATCTCCTTCTCTTCCTCCTCAGG + Intergenic
1092896114 12:13012198-13012220 AATGGCTTCTTTTCATCATTCGG + Intergenic
1093387453 12:18575633-18575655 GATGCCTTCTCTACCTCACTTGG - Intronic
1093803837 12:23408172-23408194 AAAGCCTTCTCTCTCTCATCAGG - Intergenic
1095144207 12:38705010-38705032 AATTCCATCTCTTCCTTACCAGG + Intronic
1095793010 12:46187701-46187723 ACCCCCTTGTCTTCCTCATCTGG + Intronic
1097447008 12:59683817-59683839 AATGGCTACTTTTCCTCATTAGG - Intronic
1099615078 12:84923909-84923931 AATGCCTGCTCTCCCACATGTGG + Intergenic
1100457778 12:94768841-94768863 AAAGCCTTCTCCTCCTCTGCCGG + Intergenic
1102217101 12:111169354-111169376 AATGTCTTCTCTCCCGCTTCTGG - Intronic
1102562812 12:113774532-113774554 GATGGTTTCTCTACCTCATCTGG + Intergenic
1102955074 12:117053880-117053902 GATGCCTGCTCTGGCTCATCTGG + Intronic
1105737880 13:23290145-23290167 AATGAATTCTCCTCCTCCTCAGG - Intronic
1106626078 13:31422288-31422310 AATGTTTTTTCTTCCTCCTCTGG + Intergenic
1106777348 13:33020949-33020971 AATGCCATCTCTTCCTTCTATGG + Intronic
1107052227 13:36063374-36063396 AATGTCTTCTCTGCCTCACAAGG + Intronic
1107394000 13:39996480-39996502 GATGCCCTGTCTTCCTCACCTGG + Intergenic
1108272418 13:48774630-48774652 ACTGCCTCCTCCTCCTCCTCTGG + Intergenic
1108705609 13:52982795-52982817 AATTATTTCTCTTCCTCCTCAGG + Intergenic
1110065991 13:71106016-71106038 ATTTCCATCTCTTCCTCCTCAGG - Intergenic
1110253264 13:73404367-73404389 GATGCCTTCTCTTAGTCATAAGG + Intergenic
1112673869 13:101675106-101675128 AATGCCATTTCATCATCATCTGG + Intronic
1114144068 14:19952415-19952437 AATGCCTTGTCTTGGACATCAGG - Intergenic
1115413328 14:33101580-33101602 TATGCTTTCTCTACCTGATCAGG - Intronic
1115741310 14:36391966-36391988 AATGCCCTCTCCTGCCCATCAGG - Intergenic
1117078755 14:52129872-52129894 AATTTCTTCTCTCCCTCTTCTGG + Intergenic
1117201124 14:53391188-53391210 TAAGCCATCTCTTCCTCATAAGG + Intergenic
1117234136 14:53753449-53753471 AATTCCTTCTCTGTGTCATCTGG - Intergenic
1117911839 14:60644059-60644081 CATGCCGTCTCTTCCTACTCCGG - Exonic
1118713269 14:68539840-68539862 AGGGACTTTTCTTCCTCATCTGG + Intronic
1119270457 14:73299246-73299268 AAGGCCTTCTATTCCTGATAAGG + Intronic
1119474815 14:74920949-74920971 CATGCCTCAGCTTCCTCATCTGG + Intronic
1120482474 14:85068762-85068784 ATTGTCTTTTCTTCCTCTTCAGG + Intergenic
1121544488 14:94753431-94753453 AAAGTCTGCTCTTCCCCATCCGG - Intergenic
1122559789 14:102604543-102604565 AATGCCTCTGTTTCCTCATCTGG - Intronic
1125416722 15:39461421-39461443 TATGCCTTCATTTCCTCCTCAGG - Intergenic
1126067463 15:44837150-44837172 CATGCCTGCCCTTCCACATCTGG + Intergenic
1127278611 15:57469433-57469455 TGTGTCTTCTCTTCCTCCTCAGG - Intronic
1127290777 15:57569148-57569170 AAGGCCTTTTCTTCCTCATCTGG - Intergenic
1128907551 15:71481542-71481564 AAGGTCTTCTCTTCTCCATCTGG - Intronic
1129804399 15:78443005-78443027 AAGGTCTTCTCTTACTCATGGGG + Intronic
1130021568 15:80235751-80235773 AATCCCTTCTTCTCCTCAACAGG + Intergenic
1130205048 15:81868129-81868151 GATGCCATCTCTTTCTCCTCCGG + Intergenic
1131016917 15:89065447-89065469 TATGCCTCCTCTTCCTCCTGAGG + Intergenic
1131813862 15:96202105-96202127 GCTGCCTTCTCTTCCCTATCAGG + Intergenic
1132002882 15:98197537-98197559 CCTGCCTTCTCATCCTAATCTGG + Intergenic
1133326940 16:4947603-4947625 AAGGCCTCCCCTTCCTCACCGGG - Intronic
1133643515 16:7740912-7740934 CATGCCTTAGCTTCCCCATCTGG + Intergenic
1135355224 16:21763480-21763502 AATCCCTTCACCTCCTCCTCTGG + Intergenic
1135453709 16:22579622-22579644 AATCCCTTCACCTCCTCCTCTGG + Intergenic
1137769592 16:51005314-51005336 AATGGTTTCTCTTCCCCAGCTGG + Intergenic
1139211768 16:65084780-65084802 AAAGCCTTCTCTTCCCAATTTGG + Intronic
1144325640 17:14177171-14177193 AATGTCTCGTCTTCTTCATCTGG + Intronic
1144474518 17:15574059-15574081 AATGTCTCGTCTTCTTCATCTGG + Exonic
1144811869 17:18005708-18005730 TGGGCCTTATCTTCCTCATCTGG - Intronic
1146032110 17:29374994-29375016 AATGCCATCTCTTGCTCTACTGG + Intergenic
1146923208 17:36727494-36727516 CATGCCTTCTCTTCCCCACCAGG - Intergenic
1147311937 17:39600612-39600634 TCTGCCTTCTCTTTCTCCTCAGG + Intergenic
1150436099 17:65155336-65155358 AGTACCTTGTCTTGCTCATCTGG + Intronic
1150632744 17:66891540-66891562 AAGGCCTGGTCTTCCTCATAGGG + Intergenic
1152350027 17:79778999-79779021 CCTGCCTTCCCTTCCTCCTCTGG + Intronic
1152411263 17:80124508-80124530 TATGCCTGCTCTTCCTGATCTGG + Intergenic
1152741724 17:82021362-82021384 AGTGCCTTCTCTACCTTTTCTGG - Intronic
1155431106 18:25759669-25759691 AATGTCTTCTGTTCCACCTCTGG + Intergenic
1155535041 18:26808304-26808326 AATGCCTTCTCATCTTCAAGAGG + Intergenic
1155693606 18:28656698-28656720 AATATCTCCTATTCCTCATCAGG + Intergenic
1155926458 18:31660508-31660530 AATGCCTTATCTTCCTTTCCAGG - Intronic
1156533921 18:37844941-37844963 AGTGCCTCAGCTTCCTCATCAGG + Intergenic
1158117765 18:54015550-54015572 AATGCCTTCTCTCTAACATCAGG - Intergenic
1159746131 18:72237176-72237198 AATGCCATCTTTTCCCCACCGGG - Intergenic
1159767491 18:72508106-72508128 AGTTCCTTCACTTCCTCCTCAGG - Intergenic
1161504671 19:4637453-4637475 AATCCCATCTCTGCCTCATCTGG + Intergenic
1162162458 19:8728796-8728818 TATGCCTTCTTCTCTTCATCAGG + Intergenic
1164401706 19:27906499-27906521 GATACCTACTCTTGCTCATCTGG + Intergenic
1164961758 19:32437528-32437550 AATGCTCTCTGTTCCTCAGCTGG - Intronic
1168635571 19:57993739-57993761 ACTCCCTTCTCTTCCCCACCTGG - Intronic
925108459 2:1312915-1312937 ATTTGCTTCTCTTCCTCATCAGG - Intronic
925148505 2:1599132-1599154 ACTGCCTTCTCTGCCTCAGTAGG + Intergenic
926003542 2:9353665-9353687 CATTCCTCCTCTTCCTCATCTGG + Intronic
926509701 2:13759715-13759737 CCTGCCTTGTCTTCCTCATAGGG + Intergenic
929431189 2:41888028-41888050 AATTCCTTCTTTTCCTTTTCAGG + Intergenic
931670391 2:64642017-64642039 CATTTCTTCTTTTCCTCATCAGG + Intronic
932127821 2:69160360-69160382 AATGCCGCATCTTCCTCTTCTGG + Intronic
932400709 2:71479284-71479306 AATGCCTTCTCTTCTTCTTTGGG + Intronic
933724479 2:85418796-85418818 AAGGCCATCTCTTCCCCAGCAGG - Intronic
934724802 2:96609087-96609109 AAGGCCTTTTAGTCCTCATCTGG + Intronic
935094922 2:99935144-99935166 ACTGCCTTCTCTTGCACATGTGG + Intronic
938200103 2:129365985-129366007 CATGTCTTCTCTTCCCCATGGGG - Intergenic
938488838 2:131745787-131745809 GATGCCTTCTCATCCTTTTCAGG + Intronic
939184093 2:138840382-138840404 TATGCCTTCTCTCCCTCCTCTGG + Intergenic
941443072 2:165562965-165562987 ACTGTCTTCTCTCCTTCATCAGG - Intronic
941734149 2:168954541-168954563 AATGCCATCTCTTTCTCTTCTGG + Intronic
942897187 2:181071220-181071242 AATGGCTCCTCTTTTTCATCAGG + Intronic
943230742 2:185247761-185247783 ACTTCCTTCTCTTCTTCCTCTGG + Intergenic
944682752 2:202091855-202091877 ATTGCTTTCTCTTCTTCCTCAGG - Intronic
945205129 2:207323420-207323442 AATGTATTCTCTTTCTCTTCTGG - Intergenic
946180314 2:217945162-217945184 CCTTCCTTCTCTTCCGCATCTGG + Intronic
946869870 2:224075623-224075645 GCTTCCTTCTATTCCTCATCTGG - Intergenic
947706638 2:232281729-232281751 AATGCCTGCTCTTCCTCCCCTGG - Intronic
948298777 2:236886166-236886188 ACTGCCTTCTCTTCACCAACAGG - Intergenic
948618393 2:239216524-239216546 AAAGCCTTCTCTTCTTCAGAAGG - Intronic
1170879911 20:20287863-20287885 AATGCTTTCTCATGCTCATCTGG - Intronic
1172466282 20:35157206-35157228 TGTGCCTTCACTTTCTCATCTGG - Intergenic
1174490782 20:50893500-50893522 AATGCCTCTTCTCTCTCATCGGG - Exonic
1174795955 20:53522734-53522756 AATCCCAGCTCTTCCTCATGTGG + Intergenic
1175501008 20:59450764-59450786 AATCCCTTCTCTCCATCCTCTGG + Intergenic
1175683352 20:61007572-61007594 AATGGATTCTCTTCCCCATAAGG - Intergenic
1178269685 21:31178242-31178264 AATGCCTTCTCTCCACCAGCAGG + Intronic
1180106442 21:45621872-45621894 AATGCCTTCTCTTCCACGTGTGG + Intergenic
1180160713 21:45997678-45997700 CACGCCTCCTCTTCCTCCTCAGG + Exonic
1181113143 22:20613471-20613493 AATGCCACCTGCTCCTCATCGGG + Intergenic
1182361767 22:29750682-29750704 AATCATTTCTCTTCCTCATCTGG - Intronic
1182806268 22:33073139-33073161 AATGCCTTCTATTTCTGTTCAGG + Intergenic
1183273322 22:36875631-36875653 CATCCCTTCTCTTCCTCTGCAGG + Exonic
1183758857 22:39797495-39797517 AGTCCTTTCTCTTCCTCATTTGG + Intronic
1184429431 22:44432744-44432766 AATGTATTCTCTTCCTGTTCTGG + Intergenic
949485265 3:4531946-4531968 AATGCCTCCACTTTCTCATCTGG + Intronic
950202795 3:11056841-11056863 AATGCCTCTTCTTCTTCACCTGG + Intergenic
950892075 3:16413138-16413160 ACTGCCATGTCTTCCTCCTCAGG - Intronic
951021641 3:17787300-17787322 ACTTCCCTCTCTTCCTCCTCTGG + Intronic
951040609 3:17984948-17984970 ATTGCCTTCTCTCTCTCATTAGG + Intronic
951040621 3:17985162-17985184 ATTGCCTTCTCTGTCTCATTAGG + Intronic
952183847 3:30946925-30946947 CATGTCTTCTCTTCCTCATAAGG + Intergenic
952253937 3:31679606-31679628 ACTGCCTTCTCTACCTTCTCTGG + Intronic
953012236 3:39038099-39038121 TACACCTTCTCTTCCTCATGGGG - Intergenic
953693544 3:45140032-45140054 GATGCCTTCTGTTACTGATCTGG - Intronic
953951500 3:47194006-47194028 AATGCCTCCTCTACCTCATAGGG - Intergenic
953981356 3:47414717-47414739 AATGCCCTCTGTTCTTCATCAGG + Intronic
955383227 3:58458179-58458201 GAAGCCTTCTCTTTTTCATCTGG + Intergenic
955922751 3:63974579-63974601 AAAGCCTTGGCTTCCTCATCTGG + Intronic
955952595 3:64257415-64257437 TATGCCTTTTCTTCTCCATCAGG - Intronic
962696828 3:137957603-137957625 AAAGCCTGCTGTTCCTCATGTGG + Intergenic
962878394 3:139553599-139553621 AACAGCTTTTCTTCCTCATCTGG - Intergenic
964616257 3:158669486-158669508 AATGTGTTGTCTTCTTCATCTGG + Exonic
964762078 3:160144035-160144057 AATGCCTCTTCTTCCTCAAAGGG + Intergenic
964791304 3:160454693-160454715 ATTGCCTCCTCTTCCACACCTGG - Intronic
968273897 3:197425238-197425260 ATTGCCTTTTCTTCCTCAGGAGG - Intergenic
969460672 4:7327179-7327201 AATGCATCCTCTTCCTGTTCTGG + Intronic
969549788 4:7857368-7857390 AGTGAGTTCTCTTCTTCATCTGG - Intronic
970878321 4:20898082-20898104 AGTTCCCTCTCTTCCTCAGCTGG + Intronic
971747941 4:30609456-30609478 AATGCCTTCTGCTCCTAATATGG - Intergenic
971870389 4:32228584-32228606 AAAGCATTTTCTTCTTCATCTGG - Intergenic
974079874 4:57200938-57200960 AATGTCTCCTCTTACTCATTAGG + Intergenic
975185332 4:71395429-71395451 CTAGTCTTCTCTTCCTCATCTGG + Intronic
977136369 4:93309847-93309869 AATAAATTCTCTTCCTCATAAGG - Intronic
977386139 4:96341652-96341674 ACTCCTTTCTCTTCCACATCAGG - Intergenic
979684527 4:123496719-123496741 ACTGCCTTCCCTTCCTCCACAGG + Intergenic
981644663 4:146985440-146985462 ATTGCCTCCTCTTGCTGATCAGG + Intergenic
983680378 4:170346295-170346317 AATGCTTTCTGTTGGTCATCAGG + Intergenic
983975485 4:173928600-173928622 CATGCCTTCTCTTCATCTTCAGG - Intergenic
984848351 4:184127915-184127937 AATGCTTTCTCTTCCTTCCCTGG - Intronic
984970244 4:185182278-185182300 AATGCCCTCTCTGCCTATTCAGG + Intronic
986208177 5:5645768-5645790 GAAGCCTTCTCTTCCTCTGCTGG - Intergenic
986328128 5:6695107-6695129 AATGCCTACTATTACTCATATGG + Intergenic
987790989 5:22567398-22567420 ATGGCCGTCTCTCCCTCATCAGG + Intronic
988527814 5:32001796-32001818 ACTGCCTCCTCTTTCTCACCAGG - Intronic
988822045 5:34896787-34896809 AATGGCTTCTCTTCTCCATCTGG - Exonic
988845458 5:35123029-35123051 GATTCTTTCGCTTCCTCATCTGG - Intronic
991035482 5:62123743-62123765 AATGGCATCTCTTCTTCATTTGG - Intergenic
991388321 5:66114935-66114957 TATGCCTTCTATTTTTCATCTGG + Intergenic
993191697 5:84691239-84691261 ATTTCCTTCTATTCCTCCTCAGG + Intergenic
993522029 5:88914884-88914906 AATGCCTTCTCTTTATAAACTGG - Intergenic
993626388 5:90229622-90229644 AATGTCTTCTTTTCCTCTTTTGG - Intergenic
994496251 5:100517257-100517279 ACTTCCCTCTCTTCCTCACCGGG + Intergenic
999288261 5:150407021-150407043 AATTCCAGCCCTTCCTCATCTGG - Intronic
999451207 5:151679520-151679542 TATGCCTTCTCTTCCTCCCCTGG - Intronic
999666572 5:153918563-153918585 AATGCCTTCTCTTTAGCATGAGG - Intergenic
1002077991 5:176720721-176720743 AATGCCCTTTCTTCCCCCTCAGG + Intergenic
1002110198 5:176903849-176903871 TAAGCCTTTGCTTCCTCATCTGG + Intergenic
1003564973 6:7215053-7215075 TCTGCCTTCTCTCCCTCATCTGG - Intronic
1004222535 6:13759080-13759102 ATGGCCTTCTCTTCCTCATGAGG - Intergenic
1005975651 6:30796622-30796644 AATTCATACTCTTACTCATCTGG - Intergenic
1008471349 6:51888823-51888845 CAAGCCTTCTCTTTATCATCAGG + Intronic
1008868514 6:56244729-56244751 AATGCCTTTTATGACTCATCTGG - Intronic
1009046013 6:58238158-58238180 ACTGCCTTTGCTTTCTCATCTGG - Intergenic
1009221823 6:60992469-60992491 ACTGCCTTTGCTTTCTCATCTGG - Intergenic
1010297049 6:74210580-74210602 GCTGCCTTCTCTCCCTCTTCAGG + Intergenic
1010655933 6:78510975-78510997 AATGTCTTCCCTTCCACCTCGGG - Intergenic
1013760142 6:113508898-113508920 TTTACCTTCTCTTCCTCTTCTGG + Intergenic
1016936845 6:149454188-149454210 CATGCATTCCCTTCCTCATTAGG - Intronic
1017573565 6:155775482-155775504 AACAGCTTCTATTCCTCATCTGG + Intergenic
1018855380 6:167670653-167670675 CATCCCTTCTCTTCCTCCTGTGG + Intergenic
1019142000 6:169954181-169954203 AAGGACTTCACTTCCTCCTCTGG + Intergenic
1019325225 7:434862-434884 AACGGCTGCTCTTCCCCATCCGG - Intergenic
1019971275 7:4542900-4542922 GATGCCTTCTCTCCCTCGCCTGG + Intergenic
1020663164 7:11006460-11006482 TATGCCTTCTTTTCTCCATCAGG + Intronic
1022691825 7:32663633-32663655 AATCCCTTTTCTTCCACATAAGG - Intergenic
1022919487 7:34998182-34998204 AATGCCTTTTCTTCCACATAAGG - Intronic
1023137425 7:37066238-37066260 GATTCCATCTCTTCCTCATGTGG - Intronic
1024627365 7:51219637-51219659 ATTGCATTTTCCTCCTCATCAGG - Intronic
1024717343 7:52094568-52094590 AATACATTCTCTTTCTCTTCTGG - Intergenic
1027124529 7:75546898-75546920 AATGCCTCCTCTTCCTGCCCAGG + Intronic
1028220694 7:88193188-88193210 AATGCCTCCACTTCCTGATGAGG + Exonic
1029658949 7:101946195-101946217 AAACCCTTCTCTTCCTGACCCGG - Intronic
1031758270 7:125674869-125674891 AATGCCTTCTCTGCCTCTACAGG + Intergenic
1031832688 7:126646600-126646622 AATGCCTTCTCTTAAGCATGTGG - Intronic
1032668679 7:134063946-134063968 AATGCCTTCTCTCCTTCTTCAGG + Intronic
1032680646 7:134179380-134179402 AATGGCTTCTCTTCTTCATGTGG + Intronic
1032845535 7:135748711-135748733 AATGCCTACTCTGCCTCAGAAGG + Exonic
1033324820 7:140368673-140368695 AGTGTCTGCTCTTCATCATCTGG + Intronic
1033607983 7:142941413-142941435 AATGACCTCTCTTCCTGCTCAGG - Exonic
1034445546 7:151112241-151112263 ACAGCTTTCTCTTCCTCACCTGG - Intronic
1036673932 8:10813407-10813429 AATGCCTTAAGTTCCTCATGGGG - Intronic
1038873659 8:31523521-31523543 AATGCCTTGTTTTCCTCAAAAGG + Intergenic
1039854500 8:41400566-41400588 TATACCCTCTCTTCCTCATTTGG + Intergenic
1040558378 8:48501084-48501106 AATGACTTTTCTTTCTCATTTGG + Intergenic
1040948756 8:52914364-52914386 CATGCCTTAGTTTCCTCATCTGG + Intergenic
1041124256 8:54619057-54619079 AACCTCTTCTCATCCTCATCTGG - Intronic
1041388463 8:57328519-57328541 AGTTCCTTCACATCCTCATCAGG - Intergenic
1041572806 8:59356797-59356819 CTTCCCTTCCCTTCCTCATCTGG + Intergenic
1041766809 8:61427414-61427436 GATTCATTCTCTTGCTCATCGGG - Intronic
1042096843 8:65225459-65225481 AATGACTTCTCTTCCTGAAGTGG + Intergenic
1042511285 8:69614607-69614629 CCAGCCTTCTCTTCTTCATCAGG + Intronic
1044652790 8:94515699-94515721 AATGCCTACTCTTAGTTATCTGG + Intronic
1045325480 8:101114605-101114627 GATGCCTCCTTCTCCTCATCCGG - Intergenic
1045648269 8:104320191-104320213 TGTGCCTTGGCTTCCTCATCGGG - Intergenic
1046625711 8:116574810-116574832 AGTGCATGCTCTTCCTCAACTGG + Intergenic
1046704898 8:117439004-117439026 AATCCCTTCTTTAGCTCATCTGG - Intergenic
1048878633 8:138855915-138855937 AAGGCCTCCTCTTCCACAGCAGG - Intronic
1050681732 9:8119208-8119230 TATGCCTTTGGTTCCTCATCTGG + Intergenic
1051565333 9:18490679-18490701 CCTGCCTTTTCTTACTCATCTGG - Intronic
1053069044 9:35090157-35090179 AGTGGCTCCTCTTCCTCCTCGGG + Exonic
1055038505 9:71843987-71844009 GTTGCCTTCTCATCCTCACCAGG - Intergenic
1056446890 9:86674989-86675011 AATGTCCCCTCTTGCTCATCAGG - Intergenic
1057288188 9:93777625-93777647 AGAGCCTTCTTTTCCTCCTCAGG - Intergenic
1057722417 9:97543768-97543790 CACGCCTTCTCTTCCACAGCAGG - Intronic
1057745990 9:97751741-97751763 AATGCCATCTCTCCTTCATGGGG + Intergenic
1058351606 9:104031537-104031559 AATGCCTTCCGTACCCCATCTGG + Intergenic
1059787124 9:117598079-117598101 AAATCCTTCTTTTCCTCATGAGG - Intergenic
1060378240 9:123138514-123138536 AATGCTTTCTCTTCCCCACACGG + Intronic
1061742611 9:132717993-132718015 GATGCCTTCTTTTCCAGATCAGG + Intergenic
1062241561 9:135543365-135543387 AATGCTTTCTCTTTAACATCAGG - Intergenic
1186307088 X:8273460-8273482 AATGCCTTCCCTTCCTAGACAGG - Intergenic
1188086108 X:25903704-25903726 TGTGCCTTCTTTTCCTCATTTGG + Intergenic
1188485972 X:30682878-30682900 ACTGTCTTCTCATCCTCATATGG + Intronic
1188808077 X:34616000-34616022 AATGCCTTCATTTCCCCTTCAGG - Intergenic
1188945128 X:36291156-36291178 AATGCTAGCTTTTCCTCATCAGG - Intronic
1189449121 X:41110806-41110828 AATGGCTTCTCTTCTCCATCTGG - Intronic
1193374090 X:80737439-80737461 AATGACTTTTGTTCCTCAGCTGG + Intronic
1195659209 X:107361808-107361830 CAGGCCTCCACTTCCTCATCTGG + Intergenic
1196866779 X:120077784-120077806 AACGCGTGCTCTCCCTCATCCGG - Intergenic
1196876320 X:120158497-120158519 AACGCGTGCTCTCCCTCATCCGG + Intergenic
1198936404 X:141905285-141905307 GCTTCCTCCTCTTCCTCATCTGG - Intronic
1199514378 X:148659502-148659524 AATGCCTTCATTTCATTATCTGG - Intronic
1199565131 X:149207820-149207842 AAGGCATATTCTTCCTCATCGGG - Intergenic