ID: 1089998284

View in Genome Browser
Species Human (GRCh38)
Location 11:122929494-122929516
Sequence GGCTGCTATTTGTATGGTCT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130
Summary {0: 1, 1: 0, 2: 1, 3: 10, 4: 118}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089998276_1089998284 28 Left 1089998276 11:122929443-122929465 CCGGGCAAAGGTGTGAAAGTGGG 0: 1
1: 1
2: 2
3: 18
4: 220
Right 1089998284 11:122929494-122929516 GGCTGCTATTTGTATGGTCTAGG 0: 1
1: 0
2: 1
3: 10
4: 118
1089998282_1089998284 -10 Left 1089998282 11:122929481-122929503 CCATGACAGCTCTGGCTGCTATT 0: 1
1: 0
2: 2
3: 9
4: 160
Right 1089998284 11:122929494-122929516 GGCTGCTATTTGTATGGTCTAGG 0: 1
1: 0
2: 1
3: 10
4: 118

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089998284 Original CRISPR GGCTGCTATTTGTATGGTCT AGG Intronic
902801884 1:18835562-18835584 GGCTGCTGTCTTTCTGGTCTGGG - Intergenic
906760701 1:48374858-48374880 GGCTGATATTTATATGGTTTTGG - Intronic
913061073 1:115208669-115208691 GGCTGCGAGTTGGATGGCCTTGG + Intergenic
913656645 1:120966750-120966772 GGCTTCTATTTGTGTGTCCTTGG + Intergenic
914521198 1:148417998-148418020 GGCTTCTATTTGTGTGTCCTTGG + Intergenic
914646609 1:149658487-149658509 GGCTTCTATTTGTGTGTCCTTGG + Intergenic
917513598 1:175688612-175688634 GGATGCAATTTGCATGGTGTGGG + Intronic
917563314 1:176182741-176182763 GGCTGATACAGGTATGGTCTTGG - Intronic
920673998 1:208026263-208026285 GGCTGCCAGGTGTCTGGTCTGGG + Exonic
922991754 1:229920006-229920028 GGCTGCTATTTTTAATTTCTAGG + Intergenic
923820779 1:237438254-237438276 GTCTGCTAGTTGTAGGATCTGGG + Intronic
1063543025 10:6953812-6953834 GGCTGCTCTTTGGCTGGTGTTGG - Intergenic
1064368643 10:14730859-14730881 TGCTGCTACTGGTGTGGTCTAGG - Intronic
1068794307 10:61061200-61061222 CGCTGCTAGTTGTGTGATCTTGG + Intergenic
1069746119 10:70716113-70716135 GACTGCTGTTTGGATAGTCTTGG + Intronic
1072238746 10:93475762-93475784 TGCTGGTATTTGTCTGGTATGGG - Intronic
1076677713 10:132156080-132156102 GGCTGCAGTTTGGATGGTCTGGG - Intronic
1079381144 11:19938619-19938641 GGCTGCCATTTGTAACCTCTAGG + Intronic
1080328070 11:31101513-31101535 GGCTGCTATCTCTATAGTTTAGG - Intronic
1080989357 11:37511635-37511657 GACTGCAGTTTGTCTGGTCTAGG + Intergenic
1081416067 11:42817761-42817783 GGGTGCTATTTCTCTGGACTAGG - Intergenic
1084835357 11:71797954-71797976 GCCTGCTATATATATGTTCTAGG - Intronic
1089998284 11:122929494-122929516 GGCTGCTATTTGTATGGTCTAGG + Intronic
1092785294 12:12020889-12020911 GGTTGCTATTTCCATTGTCTGGG - Intergenic
1096483809 12:51962286-51962308 GGAAGCTATTTGTATGGTGGGGG - Intronic
1097820456 12:64123552-64123574 AGCTGCTATTTATATTGTTTTGG + Intronic
1097947556 12:65388705-65388727 GGCTAATTTTTGTATGTTCTTGG - Intronic
1098648560 12:72937349-72937371 GGCTGCTTTCTGTATTGTGTAGG + Intergenic
1101224852 12:102677923-102677945 GGATGCTATTGGAACGGTCTTGG - Intergenic
1101260021 12:103019477-103019499 GGCTTCTATTGGTAGGGGCTGGG + Intergenic
1104985397 12:132593730-132593752 GGGTGCCATTGGTATGGTCTGGG - Intergenic
1106331835 13:28746521-28746543 GGATGCTGTTTGTAGGGACTGGG - Intergenic
1110756622 13:79182624-79182646 TGCTCCTTTTTGTATGCTCTTGG - Intergenic
1113236158 13:108277619-108277641 GGCTGCTCTGTCTATGGTTTCGG - Intronic
1114341089 14:21745159-21745181 GGTTGCTATTTGCATGGCATAGG - Intergenic
1114374255 14:22126744-22126766 GGCTGCTATTTGAATGTTTGGGG - Intergenic
1115342733 14:32309454-32309476 GGATGCTTTTTGTATTGTATTGG - Intergenic
1116693442 14:48141142-48141164 GGCTACTATTTGTAAGGTTTTGG + Intergenic
1119414932 14:74463540-74463562 GGCTACTCTTTGTGCGGTCTCGG + Intergenic
1120577961 14:86207583-86207605 GGCTGTTATTAGTCTGTTCTTGG + Intergenic
1123779290 15:23609463-23609485 GGCTGCTGTTTGAATGAGCTGGG - Intronic
1124473294 15:30007811-30007833 AGCTGCTATTTGAATGGTCTAGG - Intergenic
1125811303 15:42543769-42543791 AGCTGCTATTTATATGGTGAGGG - Exonic
1133348650 16:5087294-5087316 GACTGCTATATGTATATTCTAGG + Intronic
1134562024 16:15219069-15219091 GCCTGCTTTTTGTCTGGTTTGGG - Intergenic
1134623605 16:15708331-15708353 GGCTTCTAGTTGGCTGGTCTGGG - Intronic
1134922562 16:18130695-18130717 GCCTGCTTTTTGTCTGGTTTGGG - Intergenic
1135632262 16:24045644-24045666 GGCTGCTCTGGGTGTGGTCTGGG + Intronic
1135900623 16:26456250-26456272 GGCTGATACATGTGTGGTCTGGG + Intergenic
1137519168 16:49177440-49177462 GGCTGCTATTTCTGTAGTCTTGG - Intergenic
1138540555 16:57684944-57684966 GCCTGCTATGTGTGTGATCTTGG + Intronic
1144309923 17:14004158-14004180 GGCCTGTTTTTGTATGGTCTAGG - Intergenic
1150200426 17:63350638-63350660 GGCTGCTTTAGGTATAGTCTAGG + Intronic
1151714981 17:75826731-75826753 GGATCCTCTTTGCATGGTCTCGG + Intergenic
1151781147 17:76246363-76246385 GGCTACCACTTGTATGGTCTTGG - Intergenic
1154380199 18:13842871-13842893 GCCTACTATTTTTATGGCCTTGG + Intergenic
1155298706 18:24409175-24409197 GGCTGCCATGTGTCTGGTCCAGG + Intergenic
1157829214 18:50841004-50841026 GGCTGCCAGTTGTCTGGTTTGGG + Intergenic
1158245492 18:55427773-55427795 ACCTGCTATTTGTATGGAATTGG + Intronic
1162066854 19:8131202-8131224 GGCTGCTGTTTGGAGGGGCTGGG + Intronic
1165727012 19:38119907-38119929 GGCGGCGATTTGTATGGTTTCGG + Intronic
1167987531 19:53331651-53331673 TGTTGCTATTTCTATGTTCTTGG + Intergenic
925894570 2:8461427-8461449 ATCTGCTAATTGTATGGCCTTGG + Intergenic
928659123 2:33482734-33482756 CACTGCTATTTTTATGATCTTGG - Intronic
929083946 2:38149107-38149129 GGCTGCTGTTGGACTGGTCTAGG - Intergenic
929796942 2:45067163-45067185 GGCTCCTATTTGTGTGACCTTGG + Intergenic
930575457 2:53141494-53141516 GGCTGCTATTGGTATTATCTAGG - Intergenic
933892141 2:86781703-86781725 GGATTCTAATTGTGTGGTCTTGG + Intergenic
939341385 2:140899410-140899432 AGCTGCTATTTTTATGGTGAGGG + Intronic
940550236 2:155144951-155144973 GTCTGCTATTTCTAGGGCCTTGG + Intergenic
940554929 2:155212401-155212423 GGGTGCTACTTGTATGTACTGGG + Intergenic
941513884 2:166447685-166447707 CATTTCTATTTGTATGGTCTTGG + Exonic
941825875 2:169895883-169895905 TGCTGTTATTTTTATGGTGTAGG + Intronic
946321384 2:218956506-218956528 GGCTGCCAGTTGTATGACCTTGG - Intergenic
1171247943 20:23628438-23628460 GCCTGCTACTTGTAAGGTCCAGG + Exonic
1175149424 20:56921488-56921510 GAGTGCTCTTTGTTTGGTCTGGG - Intergenic
1179838055 21:44050511-44050533 GGGTGCTATGTGTATTTTCTTGG + Intronic
1182145028 22:27992298-27992320 GGCTGCTATTGGCATTGTCATGG - Intronic
1182794875 22:32984603-32984625 GAGTGCAATTTGTAGGGTCTTGG + Intronic
1183916161 22:41121258-41121280 GGTAGCTATTTGTATGGTGGTGG + Intronic
955370997 3:58351805-58351827 GGCTGCTTTTTGTTTTTTCTGGG + Intronic
955896077 3:63701583-63701605 GCATGCTTTTTCTATGGTCTTGG + Intergenic
956613697 3:71150220-71150242 GGATGCTATTTGGATGGAGTGGG + Intronic
959662873 3:108888835-108888857 GGGTGAAATTTTTATGGTCTGGG - Intergenic
964218210 3:154312976-154312998 GACTGTTATTTTTATGGTATTGG - Intronic
966390537 3:179448383-179448405 GGCTATTATTTGTATGGTAGAGG - Intronic
969758186 4:9163760-9163782 GCCTGCTATATATATGTTCTAGG - Intergenic
970101461 4:12527254-12527276 GCTTGCTATTTGTTTGCTCTTGG - Intergenic
970278726 4:14430287-14430309 GGTGGCTATTTGAATGATCTCGG + Intergenic
970501463 4:16681385-16681407 GGCTCTTATCTGTAGGGTCTTGG - Intronic
971235152 4:24834852-24834874 GGCTGCTGCTTTTGTGGTCTGGG - Intronic
972684773 4:41341522-41341544 GGCAGGTATTTTTGTGGTCTGGG + Intergenic
973218561 4:47699395-47699417 GACTGCAATTTTGATGGTCTTGG - Intronic
974776472 4:66489669-66489691 GGCTGCTATTTGTCAACTCTAGG + Intergenic
975315707 4:72950755-72950777 GGCTCCTATCTGGAGGGTCTGGG + Intergenic
985662577 5:1164450-1164472 GGGTGCTATGTGTCTGGTCCTGG - Intergenic
990394585 5:55363746-55363768 AGCTCCTATTTGTTTAGTCTTGG + Intronic
991284938 5:64962644-64962666 GTATGCTATTTATATGGTATAGG + Intronic
995850212 5:116537031-116537053 GGCTGCTCTTATTATGGACTTGG - Intronic
1002092121 5:176811750-176811772 GGGTGCCATTTGTGTGGTCAAGG + Intronic
1003844255 6:10156341-10156363 GCCTGTTATCTGGATGGTCTAGG - Intronic
1004545946 6:16598581-16598603 GGCTGCTGTGGGTGTGGTCTGGG - Intronic
1007826757 6:44606587-44606609 CGCTTCTATTTGGATGGCCTTGG + Intergenic
1008061921 6:47007576-47007598 GGATGCTATTTGTTTGGGTTGGG - Intronic
1009476980 6:64104913-64104935 GGCTACTATTTGTGTGTCCTGGG + Intronic
1018376054 6:163213926-163213948 GGCTACTTTTTATATGGTGTTGG - Intronic
1021333262 7:19365852-19365874 GGATGCTATTTGGAGGGGCTGGG - Intergenic
1024242260 7:47444759-47444781 GGTTGCAATTTGTATGGTTTCGG - Intronic
1024375267 7:48630257-48630279 GGATGCTATTTGCATTGCCTGGG - Intronic
1026218659 7:68372361-68372383 GGCTGCTATCTGACTGGCCTTGG - Intergenic
1029295227 7:99535124-99535146 GGCTGTAATGTGAATGGTCTGGG - Intergenic
1030328854 7:108251614-108251636 GGCTGCTGGTTGTTGGGTCTAGG + Intronic
1030800340 7:113842356-113842378 GGGTGCTATTTTTATAATCTAGG + Intergenic
1033656965 7:143381232-143381254 GGCCGCTCCTTGTATGGTCTGGG + Exonic
1033930127 7:146509659-146509681 GGCTGCTATTAGTGTAGGCTTGG - Intronic
1034380455 7:150687820-150687842 TTCTGCTATCTGTATGGTATGGG + Intronic
1038737088 8:30180266-30180288 TGCTGCTATTTGTGTGACCTTGG - Intronic
1040414128 8:47182077-47182099 TGTTGCTATCTGCATGGTCTGGG - Intergenic
1041478819 8:58295590-58295612 GGGTGCTGTTTGTTTGGTTTGGG - Intergenic
1044289509 8:90451292-90451314 GGGTGCTATTTTAATGGTTTTGG - Intergenic
1046845546 8:118911354-118911376 ATCTGCTATTTGTGGGGTCTGGG - Intergenic
1048153739 8:131920783-131920805 TGCTTCTCGTTGTATGGTCTTGG + Intronic
1050781789 9:9345701-9345723 GGCTTCCAGTAGTATGGTCTTGG + Intronic
1055883768 9:81034315-81034337 GGCTGCTGTTTGTACTGTGTGGG - Intergenic
1056765257 9:89441216-89441238 GGTTGGTATTCGTAAGGTCTGGG - Intronic
1058495494 9:105554622-105554644 GGCTGCTTTTTATATTATCTGGG + Intergenic
1189266984 X:39724671-39724693 GGCTGCTATTGGTCTGGCTTGGG + Intergenic
1194535573 X:95102388-95102410 GGCTGCTTTTTGTATTATGTGGG + Intergenic
1195041891 X:101022066-101022088 AACTGCTAATTTTATGGTCTGGG - Intronic
1201523369 Y:14902614-14902636 GGTTAATATTTGAATGGTCTTGG + Intergenic