ID: 1089999060

View in Genome Browser
Species Human (GRCh38)
Location 11:122938115-122938137
Sequence CTGTTTTCATAGATTGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 988
Summary {0: 1, 1: 0, 2: 4, 3: 107, 4: 876}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1089999058_1089999060 -10 Left 1089999058 11:122938102-122938124 CCTTTGTATAGGTCTGTTTTCAT 0: 1
1: 3
2: 24
3: 193
4: 727
Right 1089999060 11:122938115-122938137 CTGTTTTCATAGATTGAGCTGGG 0: 1
1: 0
2: 4
3: 107
4: 876

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1089999060 Original CRISPR CTGTTTTCATAGATTGAGCT GGG Intronic
900734512 1:4288602-4288624 CTGATCTCATAGAATGAGTTAGG + Intergenic
902095413 1:13940138-13940160 ATGGTTTCATAGAATGAGTTAGG + Intergenic
903309274 1:22440983-22441005 CTGGCTTCATAGAATGAGTTGGG + Intergenic
903764124 1:25722262-25722284 CTCTTTTCATTCATTGTGCTGGG + Intronic
904124754 1:28230318-28230340 CTGTTTTCATAGAGTGAAGAGGG - Intronic
905498020 1:38410753-38410775 CTGGTTTCATAGAATGAGTTGGG - Intergenic
905711832 1:40111295-40111317 CTGACTTCATAGAATGAGTTAGG - Intergenic
906433456 1:45775047-45775069 CTGGTCTCATAGATGGAGTTGGG - Intergenic
906959408 1:50407752-50407774 CTGGTATCATAGAATGAGTTGGG - Intergenic
907531034 1:55097258-55097280 GTGTTTTCCTAGTTTAAGCTAGG + Intronic
907793046 1:57686538-57686560 CTGGCTTCATAGAATGAGTTAGG - Intronic
908345149 1:63225039-63225061 CTGTTTTCATAGAATGATTTGGG - Intergenic
908881327 1:68736613-68736635 CTGTTCTCATAAAATGAGTTAGG + Intergenic
908898421 1:68926988-68927010 CTGTTCTCATAAAATGAGTTAGG - Intergenic
908913413 1:69099032-69099054 CTGTTCTCATAAAATGAGTTAGG + Intergenic
908915080 1:69116979-69117001 CTGTTCTCATAAAATGAGTTAGG + Intergenic
909302367 1:74029703-74029725 CTGGTCTCATAAATTGAGTTAGG + Intronic
909437442 1:75659242-75659264 CTGGCTTCATAGAATGAGTTTGG - Intergenic
909703828 1:78556920-78556942 CTGGTTTCATAGAATGAATTAGG - Intergenic
909733979 1:78933064-78933086 CTGGCTTCATAAAATGAGCTAGG - Intronic
909948063 1:81686141-81686163 CTGGCTTCATAGAATGAGTTAGG + Intronic
910358403 1:86390023-86390045 CTGGTTTCATAGAATGATTTAGG - Intronic
910563931 1:88622206-88622228 CTGGTGTCATAGAATGAGTTGGG - Intergenic
910589541 1:88915070-88915092 CTGGTCTTATAGAATGAGCTAGG + Intergenic
910733484 1:90425088-90425110 CTGGCTTCATAGAATGAGTTTGG - Intergenic
911225963 1:95305879-95305901 CTATTTTTCTAGATTGAGCAAGG + Intergenic
911265607 1:95739612-95739634 CTGGCTTCATAGATTGATTTAGG + Intergenic
911511407 1:98810954-98810976 CTGGCTTCATAGAATGAGTTTGG - Intergenic
911538338 1:99127588-99127610 CTGGCTTCATAGAATGAGTTAGG + Intergenic
912127622 1:106559258-106559280 CTGGCCTCATAGAATGAGCTTGG - Intergenic
912136770 1:106669777-106669799 CTGGTCTCATAGAATGAGTTAGG - Intergenic
912161305 1:106987885-106987907 CTGGCTGCATAGATTGAGTTAGG - Intergenic
912857360 1:113181824-113181846 CTGGCTTCATAGAATGAGTTAGG - Intergenic
912889906 1:113519063-113519085 CTGTTTTCATAGAGAGAATTAGG - Intronic
912970705 1:114280030-114280052 CTGGCCTCATAGATTGAGTTAGG - Intergenic
913151654 1:116050230-116050252 CTGGCTTCATAGAATGAGTTAGG - Intronic
913464018 1:119120535-119120557 ATGTTTTCATAGAATGATTTAGG - Intronic
913663426 1:121025544-121025566 CTGGTTTCATAGAATGAGTTAGG - Intergenic
914014817 1:143808812-143808834 CTGGTTTCATAGAATGAGTTAGG - Intergenic
914163004 1:145152395-145152417 CTGGTTTCATAGAATGAGTTAGG + Intergenic
914653438 1:149717369-149717391 CTGGTTTCATAGAATGAGTTAGG - Intergenic
915085144 1:153381774-153381796 TTGGTTTCATAGAATGAGTTAGG - Intergenic
915420244 1:155775163-155775185 CTGTTTTCCCAGAAAGAGCTGGG - Exonic
915696322 1:157746225-157746247 CTGGCTTCATAGAATGAGTTAGG - Exonic
915773148 1:158451921-158451943 TTGTTTTCATAGAATGAATTAGG - Intergenic
916878396 1:168995050-168995072 CTGGTTTCATAAAATGAGTTAGG + Intergenic
916902950 1:169249979-169250001 CTGGCTTCATAGAATGAGTTAGG + Intronic
916911465 1:169352057-169352079 CTGAGCTCATAGAATGAGCTTGG - Intronic
917011562 1:170480190-170480212 CTGGCTTCATAGAATGAGTTAGG + Intergenic
917221354 1:172732112-172732134 CTGGTTTCATAGAACAAGCTTGG - Intergenic
917673274 1:177294586-177294608 CTGTCTTTATAGAATGAGTTAGG + Intergenic
917763104 1:178185890-178185912 CTGGCTTCATAGATTGAATTAGG + Intronic
917820439 1:178757796-178757818 CTGGCTTCATAGAATGAGTTAGG + Intronic
917983676 1:180293226-180293248 CTGGTTTCACAGAATGAGCTGGG + Intronic
918169143 1:181978921-181978943 CTGGCTTCATAAAATGAGCTAGG - Intergenic
918170044 1:181987800-181987822 GTGTTTTCATAGATTCCTCTGGG - Intergenic
918536454 1:185580327-185580349 CTTTTCTCATAGAATGAGGTAGG + Intergenic
918861192 1:189828348-189828370 CTGGCTTCATAGAATGAGTTAGG - Intergenic
918950480 1:191129757-191129779 CTGACTTCATAGATTCAGGTAGG - Intergenic
918966420 1:191355208-191355230 CTGGCTTCATAGAATGAGTTAGG + Intergenic
919269035 1:195314456-195314478 CTGGCCTCATAGAATGAGCTGGG - Intergenic
919627219 1:199923315-199923337 CTGGCCTCATAGAATGAGCTGGG - Intergenic
920384416 1:205558679-205558701 CTGTCCTCATAGAATGAGTTTGG - Intergenic
920998741 1:211020627-211020649 CTGGACTCATAGATTGAGTTTGG - Intronic
921197262 1:212770681-212770703 CTGTTCTCACAGAATGAGTTAGG - Intronic
921777398 1:219117464-219117486 CTGGTCTCATAGAATGAGTTAGG - Intergenic
922067877 1:222161566-222161588 CTTTTATCATAGTATGAGCTGGG - Intergenic
922275373 1:224072602-224072624 CTATTTTCACATATTGTGCTGGG - Intergenic
922365480 1:224859597-224859619 CTGTTTTAATTGATTAGGCTGGG - Intergenic
923122531 1:231006103-231006125 CTGGTTTCATAGAATGATTTAGG - Intergenic
923691649 1:236199394-236199416 CTGGTTTCATAGAATGATTTAGG + Intronic
924175095 1:241383180-241383202 CTGGTCTCATAGAATGAGTTAGG - Intergenic
924192971 1:241574771-241574793 CTGGCTTCATAGAATGAGTTAGG + Intronic
924213756 1:241797286-241797308 ATGGTTTCATTGAATGAGCTTGG - Intronic
924490997 1:244537483-244537505 CTGGCTTCATAGAATGAGTTGGG + Intronic
924906735 1:248462484-248462506 CTGACTTCATAGAATGATCTAGG - Intergenic
1063334430 10:5198327-5198349 CTGTTTTCAAAGTTGGAGCCTGG + Intronic
1063452806 10:6162935-6162957 CGTTTTTCATGGATGGAGCTGGG + Intronic
1063987266 10:11518224-11518246 CTGATTTCACAGACTGAGGTGGG + Intronic
1064635461 10:17361653-17361675 CTGTTCTCATATAGTGAGTTGGG - Intronic
1064777815 10:18798716-18798738 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1064799357 10:19051614-19051636 CGGTTTTCATAAATTGTTCTTGG - Intronic
1064833611 10:19500116-19500138 CTGGCTTCATAGAATGAGTTAGG + Intronic
1064907838 10:20366996-20367018 CTGTCTTCATAGAATGAATTAGG + Intergenic
1065471960 10:26091274-26091296 ATGTGGTCAGAGATTGAGCTGGG - Intronic
1065499989 10:26370699-26370721 CTGGCTTCATAGAATGAGTTGGG + Intergenic
1066089312 10:32002225-32002247 CTGTTTTTATATATTGTGCTGGG + Intergenic
1066089463 10:32003486-32003508 CTGTTTTTATATATTGTGCTGGG + Intergenic
1066165273 10:32781294-32781316 CTGTCCTCATAGAATGAGTTAGG - Intronic
1066485682 10:35841824-35841846 CTGATCTCATAGAATGAGTTAGG + Intergenic
1066819194 10:39463520-39463542 CTGTTTTCATAGAATCTGCAAGG - Intergenic
1067093061 10:43280811-43280833 CTGGCCTCATAGAATGAGCTAGG - Intergenic
1067579786 10:47435814-47435836 CTGGTTTCACAGAATGAGTTAGG + Intergenic
1067672616 10:48338084-48338106 CTGGTTTCAAAGAATGAGTTAGG - Intronic
1068785527 10:60968377-60968399 CTGTTTTAAAACATTGAACTAGG - Intronic
1068832804 10:61517146-61517168 TTGTTCTCATAGAATGAGTTAGG + Intergenic
1069158904 10:65065886-65065908 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1069166667 10:65168873-65168895 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1069574088 10:69514361-69514383 CTGGCTTCATAGAATTAGCTGGG + Intergenic
1069858832 10:71457617-71457639 CTGGTCTCCCAGATTGAGCTGGG - Intronic
1070080857 10:73185938-73185960 CTGGCTTCATAGAATGAGTTAGG - Intronic
1070422793 10:76253552-76253574 CTTTTTACCTAGAATGAGCTAGG - Intronic
1070870889 10:79751607-79751629 GTGGCTTCATAGAATGAGCTAGG - Intergenic
1071020322 10:81046533-81046555 CTTGTTTCATAGAATGAGTTAGG + Intergenic
1071395218 10:85216946-85216968 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1071737852 10:88321941-88321963 CTGGTTTCATAGAATGAGTTGGG - Intronic
1072136673 10:92553487-92553509 CTGATTTCATAAAATGAGTTTGG - Intronic
1072377576 10:94834005-94834027 CTGGCTTCATAGAATGAGTTTGG + Intronic
1073868263 10:107830310-107830332 CTGTTTTCATAGGTTAATTTAGG - Intergenic
1074037057 10:109750501-109750523 CTGGTTTCATAGAATGATTTAGG + Intergenic
1074210190 10:111325094-111325116 CTGGTTTCATAGAATGAGTTAGG - Intergenic
1074621373 10:115126811-115126833 ATGTTTTCATAGATTTAGAGAGG + Intronic
1074635415 10:115310342-115310364 CTGGCTTCATAGAATGAGTTAGG + Intronic
1074642222 10:115399208-115399230 CTGGCCTCATAGATTGAGTTAGG + Intronic
1074937525 10:118199307-118199329 CTGGTCTCATAGAATGAGTTGGG + Intergenic
1075179842 10:120200693-120200715 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1075938661 10:126368574-126368596 CTGCTTTCTTACATTGAACTTGG - Intronic
1076862754 10:133148373-133148395 CTGGCCTCATAGAATGAGCTGGG - Intergenic
1077859581 11:6164222-6164244 CTGGCTTCATAGAATGAGTTTGG - Intergenic
1078591628 11:12645913-12645935 CTGGCCTCATAGAATGAGCTAGG - Intergenic
1079273365 11:19010067-19010089 CTGGCTTCATAGAATGAACTAGG + Intergenic
1079324816 11:19482643-19482665 CTGTTGTCATAGGCTGAGCAAGG + Intronic
1079646664 11:22871393-22871415 GTGTTTTTATTGATTCAGCTAGG - Intergenic
1079748125 11:24159003-24159025 CTGGCTTCATAGAATGAGCTAGG - Intergenic
1079763692 11:24362200-24362222 CTGTCCTCATAGAATGAGCTTGG - Intergenic
1079863084 11:25698759-25698781 CTGGTTTTATAGAATGAGTTGGG - Intergenic
1080145222 11:28974520-28974542 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1080191608 11:29556928-29556950 CTGTTTTCATCCATTGAGATTGG - Intergenic
1080703730 11:34668453-34668475 CTGTTTTCACAGCTTCAGCAGGG - Intergenic
1080933037 11:36833442-36833464 CTGGCTTCATAGATTGAATTAGG + Intergenic
1081195553 11:40155837-40155859 CTGGCTTCATAGAATGAGTTAGG - Intronic
1081221947 11:40473090-40473112 CTGGTTTCATAGAATGAGTTAGG - Intronic
1081244702 11:40750340-40750362 CTGGCTTCATAGAATGAGTTAGG - Intronic
1081295955 11:41389609-41389631 CTGTTATCCTAGATTAGGCTTGG - Intronic
1081379544 11:42398004-42398026 CTGGCCTCATAGAATGAGCTGGG - Intergenic
1082206883 11:49447417-49447439 CTGTCTTCATAGAATGATTTAGG - Intergenic
1082303223 11:50537018-50537040 CTGTTTTTGTAGAATCAGCTAGG - Intergenic
1082585838 11:54938632-54938654 CTGTTTTCATAGAATCTGCACGG - Intergenic
1082588881 11:54980111-54980133 CTGTTTTCATAGAATCTGCGAGG + Intergenic
1082935164 11:58648336-58648358 CTGGTCTCATAGAATGAGTTCGG + Intronic
1083016972 11:59464213-59464235 CTGGCTTCATAGATTGAGTTAGG - Intergenic
1083064275 11:59907828-59907850 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1083391925 11:62358066-62358088 CTGTTTTAAAAGATTGGCCTTGG + Intronic
1083496102 11:63055102-63055124 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1083984384 11:66202340-66202362 TTGGTTTCATAGATTGAGTCTGG - Intronic
1084994142 11:72958888-72958910 CTGTTTCCATAGATGGAAATGGG - Intronic
1086309103 11:85516909-85516931 CTGGTTTCATAGGATGAGTTAGG - Intronic
1086601419 11:88638488-88638510 CTGTCTTCATTGATTGAATTAGG + Intronic
1086648389 11:89254333-89254355 CTGTCTTCATAGAATGATTTAGG + Intronic
1086844271 11:91729653-91729675 CTGACTTCATAGAATGAGTTAGG - Intergenic
1087325938 11:96723670-96723692 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1087326883 11:96735152-96735174 CTGGTTTCATCGAATGAGTTAGG + Intergenic
1087333175 11:96809716-96809738 CTGGTCTCATAGAATGAGTTTGG + Intergenic
1087604655 11:100362690-100362712 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1087679831 11:101207960-101207982 CTGTCCTCATAGAATGAGTTAGG + Intergenic
1087688652 11:101294319-101294341 CTGGTTTCATAGAATGATTTAGG + Intergenic
1087788621 11:102383933-102383955 CTGGTCTCATAGAATGAGTTAGG + Intergenic
1087865929 11:103226716-103226738 CTGGCTTCATAGATTGATTTAGG + Intronic
1088346533 11:108833335-108833357 CTTTTTCCATAGATAGAGTTGGG + Intronic
1088395909 11:109369338-109369360 CTGGCTTCACAGAATGAGCTAGG + Intergenic
1088425756 11:109700085-109700107 CTGGTTTCATAGAATGAGTTAGG - Intergenic
1088471404 11:110191077-110191099 CTGGCTTCATAGAATGAGTTAGG - Intronic
1088520864 11:110698425-110698447 CTGGTTTCATAGAACGAGTTAGG + Intronic
1088733234 11:112702815-112702837 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1089799131 11:121009833-121009855 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1089999060 11:122938115-122938137 CTGTTTTCATAGATTGAGCTGGG + Intronic
1090142937 11:124284596-124284618 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1090573945 11:128079848-128079870 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1090695754 11:129239775-129239797 CTGTTTGCACAGATTGAGGATGG - Intronic
1091052883 11:132389672-132389694 CTGTGCTCATAGAGTGAGTTTGG - Intergenic
1091708380 12:2716827-2716849 TTGATTTCATAGAATGAGTTAGG - Intergenic
1091709690 12:2730340-2730362 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1091957322 12:4657597-4657619 CTGTTGTAATAAATGGAGCTTGG + Intronic
1092028823 12:5266527-5266549 CTGGTCTCATAGAATGAGTTGGG - Intergenic
1092274835 12:7052038-7052060 CTGATTGCATAGAATGAGTTGGG + Intronic
1092608797 12:10150537-10150559 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1093150396 12:15614065-15614087 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1093278156 12:17154506-17154528 CTGTCTTCATAGAATGATTTAGG - Intergenic
1093435877 12:19134012-19134034 CTGTTTTTATAAGATGAGCTAGG - Intronic
1093491028 12:19704391-19704413 CTGGTTTCATACAATGAGTTAGG - Intronic
1093516078 12:19988540-19988562 GTGTTTTCAGAGTCTGAGCTGGG + Intergenic
1093603503 12:21060726-21060748 CTGACTTCATAGAATGAGTTAGG + Intronic
1093759146 12:22887048-22887070 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1094055018 12:26260101-26260123 CTGTCTTCATAAAATGAGTTAGG - Intronic
1094117507 12:26933346-26933368 CTGTTCTCATCCATTGTGCTAGG - Intronic
1094734514 12:33219542-33219564 CTGGTCTCATAGAATGAGTTAGG + Intergenic
1095091103 12:38106602-38106624 CTGGTCTCATAGAATGAGTTGGG + Intergenic
1095175440 12:39086649-39086671 CTGTCCTCATAGATTGAGTTTGG + Intergenic
1095248747 12:39954192-39954214 CTTTTTTGAGATATTGAGCTGGG - Intronic
1095634519 12:44417216-44417238 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1096034281 12:48450963-48450985 CTGGCCTCATAGAATGAGCTAGG - Intergenic
1096129013 12:49142582-49142604 CTGATCTCATAGAATGAGTTAGG + Intergenic
1096897318 12:54836088-54836110 CTGGTTTCACAGAATGAGTTAGG + Intronic
1097217587 12:57426349-57426371 CTTTTTTCACAGATTGATTTTGG - Intronic
1097345647 12:58489048-58489070 TTGTTTTCATACAATGAACTAGG + Intergenic
1097662148 12:62442296-62442318 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1098054395 12:66489107-66489129 CTGGTCTCATAGAATGAGTTAGG - Intronic
1098786186 12:74758875-74758897 CTGGTTTCATAGAATGATTTAGG + Intergenic
1099184373 12:79501648-79501670 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1099353777 12:81608299-81608321 CTGGCTTCATAGAATGAGTTAGG + Intronic
1099398082 12:82166833-82166855 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1099467189 12:83001985-83002007 CTGGCTTCATAGAATGAGTTAGG + Intronic
1099497880 12:83375220-83375242 CTGTCCTCATGGAATGAGCTGGG + Intergenic
1099667425 12:85650185-85650207 CTGGCCTCATAGAATGAGCTGGG + Intergenic
1099726710 12:86440110-86440132 CTGGCTTCATAGAATGAGTTAGG - Intronic
1099804106 12:87495871-87495893 CTGTTTTTAGTGACTGAGCTGGG - Intergenic
1099859953 12:88214139-88214161 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1099860989 12:88226003-88226025 CTGTTTTCATATAGTGAGTGAGG - Intergenic
1099900579 12:88706322-88706344 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1100344933 12:93719450-93719472 CTGACTTCATAGAATGAGTTAGG + Intronic
1100932248 12:99622881-99622903 CTGGTTTCATAGAAAGAGATAGG - Intronic
1101790433 12:107921568-107921590 CTGGTTTCATAAAATGAGTTAGG - Intergenic
1102503477 12:113369030-113369052 TTGTTTTCATAGTTTAAGCCTGG + Intronic
1103809786 12:123604109-123604131 CTGTTTTTAAACACTGAGCTGGG + Intronic
1104181035 12:126380997-126381019 CTGGTTTCATAGAATGATTTAGG - Intergenic
1104225276 12:126826219-126826241 CTGGTTTCATAGAATGAGTGAGG + Intergenic
1104507460 12:129345943-129345965 CTGGTTTCATAAAATGAGTTAGG + Intronic
1104677574 12:130723893-130723915 CTGTCCTCATAGAATGAGTTGGG - Intergenic
1105044453 12:132990546-132990568 CTGTCTTTATAGACTGAGTTAGG + Intronic
1105226196 13:18435210-18435232 CTGTTTTTATAGATTTGCCTGGG - Intergenic
1105240680 13:18607121-18607143 CTGTCTTCATAGAATGAGTATGG - Intergenic
1105320142 13:19311823-19311845 CTGGCTTCATAGAATGAGTTTGG + Intergenic
1105331272 13:19418258-19418280 CTGGCTTCATAGACTGAGTTAGG - Intergenic
1105445639 13:20454126-20454148 CTGCCTTCATAGAATGAGTTGGG - Intronic
1105880573 13:24602599-24602621 CTGGCTTCATAGACTGAGTTAGG + Intergenic
1105919315 13:24946568-24946590 CTGGCTTCATAGACTGAGTTAGG - Intergenic
1106147339 13:27061593-27061615 CTGCTGTCATAGAATGAGTTAGG - Intergenic
1106261524 13:28071404-28071426 CTATTTTCATCCATTGTGCTGGG + Intronic
1107093011 13:36503255-36503277 CTGGTCTCATAGAATGAGTTGGG + Intergenic
1107175982 13:37398655-37398677 CTGGCCTCATAGATTGAGTTAGG - Intergenic
1107296954 13:38919537-38919559 CTGTCTTTATAGAATGAGTTAGG + Intergenic
1107324079 13:39221756-39221778 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1108143755 13:47454590-47454612 CTGGTTTCATAGAATGAGTTGGG + Intergenic
1108183094 13:47861406-47861428 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1108882771 13:55141621-55141643 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1108884970 13:55168802-55168824 CTGTCCTCATAGAATGAGTTAGG - Intergenic
1108900433 13:55398390-55398412 ATGTTTTCAAAGATTCAGTTAGG - Intergenic
1108978045 13:56474309-56474331 CTGACTTCATAGAATGAGTTAGG + Intergenic
1109207258 13:59496394-59496416 TTGTTTTCATAAAATGAGCAAGG + Intergenic
1109227462 13:59714057-59714079 CTGTTTTAAAAAATTTAGCTAGG + Intronic
1109439487 13:62350457-62350479 CTGATCTCATAGAATGAGTTAGG + Intergenic
1109483842 13:62992921-62992943 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1109504657 13:63284733-63284755 CTGGCTTCATAGAATGAGGTAGG + Intergenic
1109877345 13:68422977-68422999 ATGGTTTCATAGAATGAGTTAGG + Intergenic
1110037162 13:70702471-70702493 AGATTTTCCTAGATTGAGCTTGG - Intergenic
1110176757 13:72566045-72566067 CTGTCTACATAGAATGAGTTTGG - Intergenic
1110402644 13:75111812-75111834 CTGGCTTCATAAAATGAGCTAGG - Intergenic
1110629167 13:77686416-77686438 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1110768105 13:79303546-79303568 CTGGTTTCATAAAATGAGTTAGG - Intergenic
1110788772 13:79564136-79564158 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1111077231 13:83252895-83252917 CTGGCTTCATAGAATGAGTTGGG - Intergenic
1111563025 13:89977702-89977724 CTGTTTTCATAGATTTATTTAGG - Intergenic
1111761683 13:92474270-92474292 CTGTTTGCATAGATTGTAATAGG + Intronic
1111970602 13:94910858-94910880 CTGACTTCATAGAATGAGCTAGG + Intergenic
1112047926 13:95616348-95616370 TTGTTTTCATAGATGGAGAAAGG - Intronic
1112055730 13:95689090-95689112 CTGGTTTCATAGAATGAGTTAGG + Intronic
1112069139 13:95828805-95828827 CTGTCCTCATAAATTGAGTTAGG - Intronic
1112165493 13:96914757-96914779 CTGGCTTCATAGAATGAGTTTGG + Intergenic
1113081944 13:106529415-106529437 CCTTTTTTATAGATTGAGATTGG - Intronic
1114132449 14:19807721-19807743 CTGGCTTCATAGAATGAGTTAGG - Intronic
1114760146 14:25305123-25305145 CTGGTCTCATAGAATGAGTTGGG - Intergenic
1114771815 14:25435808-25435830 CTGGTTTCATTGAATGAGTTAGG + Intergenic
1114904866 14:27114839-27114861 CTGGCTTCATAGAATGAGTTGGG + Intergenic
1115012674 14:28568844-28568866 CTGATTCCATAATTTGAGCTGGG + Intergenic
1115036412 14:28862340-28862362 CTGGTCTCATAGAATGAGTTAGG + Intergenic
1115134534 14:30092851-30092873 CTGGCCTCATAGAATGAGCTTGG - Intronic
1115362226 14:32516779-32516801 CTTTTTTCATTAATAGAGCTAGG - Intronic
1115381220 14:32741881-32741903 CTGGTCTCATAGAATGAGTTTGG + Intronic
1115911600 14:38262906-38262928 CTGGTTTCATAGAATGTGTTAGG - Intergenic
1116123707 14:40754816-40754838 CTGGTCTCATAGAATGAGTTAGG + Intergenic
1116193243 14:41686964-41686986 CTGGTTTCATAAAATGAGTTAGG + Intronic
1116274502 14:42813546-42813568 CTTTTTTCATGAATTGTGCTGGG - Intergenic
1116555445 14:46298488-46298510 CTGGTTTCATAGAATGAGCCAGG + Intergenic
1116708754 14:48337817-48337839 CTGGCCTCATAGAATGAGCTAGG + Intergenic
1116797478 14:49407440-49407462 CTGTTTACAGAGATTTAGCAGGG - Intergenic
1117111379 14:52459559-52459581 CTGGCTTCATAGAATGAGCTGGG - Intronic
1117169551 14:53079207-53079229 CTGGCTTCATAGAATGAGCTGGG + Intronic
1117306731 14:54484668-54484690 CTGTTCTTGTAGAATGAGCTTGG - Intronic
1117498424 14:56328757-56328779 CTTGTTTCATAGACTGATCTAGG - Intergenic
1118543852 14:66862470-66862492 CTGGTCTCATAGAATGAGTTTGG - Intronic
1118562754 14:67104363-67104385 CTGACCTCATAGATTGAGTTTGG + Intronic
1119152789 14:72378826-72378848 CTGGTCTCATAGAATGAGTTAGG - Intronic
1120139354 14:80911131-80911153 CTCCTTTCATAGATTTAGGTTGG - Intronic
1120279120 14:82416861-82416883 CTGCTTTCATAGAATGGGTTTGG + Intergenic
1120380845 14:83777361-83777383 CTGTTATCATACATTGACATGGG + Intergenic
1120439373 14:84516518-84516540 CTGGTTTCATAGAATGAGTATGG + Intergenic
1120528431 14:85604535-85604557 TTGTTTTCATAAATTGCTCTGGG + Intronic
1120748190 14:88171986-88172008 CTGATTTCATAGGATGAGTTAGG - Intergenic
1120837176 14:89050935-89050957 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1121157500 14:91700412-91700434 CTGGCTTCATAGAATGAGTTAGG + Intronic
1121284483 14:92724688-92724710 CTGGTTTGATAGCTTGTGCTGGG + Intronic
1122656370 14:103262998-103263020 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1123490589 15:20777203-20777225 CTGTCTTCATAGAATGAGTTTGG + Intergenic
1123547091 15:21346290-21346312 CTATCTTCATAGAATGAGTTTGG + Intergenic
1123569276 15:21586432-21586454 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1123575522 15:21663474-21663496 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1123605386 15:22021753-22021775 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1123612142 15:22105946-22105968 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1123766165 15:23480461-23480483 CTGGCTTCATAGAATGAACTAGG + Intergenic
1123978992 15:25581741-25581763 CTGGCTTCATAGATTGAGTTGGG - Intergenic
1124013157 15:25855115-25855137 CTGGTCTCATAGAATGAGTTGGG - Intronic
1124047291 15:26162020-26162042 CTGTTTTCTTACATGGAACTGGG + Intergenic
1124480839 15:30078212-30078234 CTTTTTTCATTCATTGTGCTGGG + Intergenic
1124838801 15:33222306-33222328 CTACTTTCATAGAATGAGTTAGG - Intergenic
1125002118 15:34782635-34782657 CTGACTTCATAGAATGAGTTAGG + Intergenic
1125371267 15:38980067-38980089 CTGGTTTCATAGAATGAGTTGGG + Intergenic
1126289358 15:47056223-47056245 CTGTTTACAGAGATGTAGCTAGG + Intergenic
1126997142 15:54457382-54457404 CTGCCTTCATAGAATGAGTTAGG + Intronic
1127524706 15:59781174-59781196 CTGTATTCATACAATGAGTTAGG + Intergenic
1128862718 15:71087765-71087787 CTGGTTTCCTAGAATGAGTTAGG - Intergenic
1130185827 15:81680835-81680857 CTGACTTCATAGAATGAGTTAGG - Intergenic
1130715889 15:86333670-86333692 CTGGTTTCATAGAATAAGTTAGG - Intronic
1131929350 15:97422190-97422212 CTGGTTTTATAGAATGAGTTGGG - Intergenic
1132037390 15:98497054-98497076 CTGATCTCATAGAATGAGTTTGG + Intronic
1132183734 15:99784106-99784128 CTGTTTGCATAGATTGTAATAGG - Intergenic
1132323862 15:100949514-100949536 CTGGTTTCATAGACTGAATTGGG - Intronic
1132434649 15:101789064-101789086 CTGTTTGCATAGATTGTAATAGG + Intergenic
1202955421 15_KI270727v1_random:73506-73528 CTGTCTTCATAGAATGAGTTTGG + Intergenic
1202977630 15_KI270727v1_random:313525-313547 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1202984390 15_KI270727v1_random:397719-397741 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1133716531 16:8454904-8454926 CTGGCTTCATAGATTGATTTAGG - Intergenic
1136715083 16:32273367-32273389 CTGGTTTCAAAGAATGAGTTAGG - Intergenic
1136752832 16:32656364-32656386 CTGGTTTCAAAGAATGAGTTAGG + Intergenic
1136815282 16:33214001-33214023 CTGGTTTCAAAGAATGAGTTAGG - Intronic
1136821758 16:33324081-33324103 CTGGTTTCAAAGAATGAGTTAGG - Intergenic
1136828321 16:33380620-33380642 CTGGTTTCAAAGAATGAGTTAGG - Intergenic
1136833387 16:33479392-33479414 CTGGTTTCAAAGAATGAGTTAGG - Intergenic
1137224151 16:46486253-46486275 CTGTATTCATAGAATGAGTTAGG - Intergenic
1137779818 16:51088538-51088560 CTGTTGTCATACCTTGAGCCTGG - Intergenic
1137852133 16:51756275-51756297 CTGTTTTTATAGATTCCTCTTGG - Intergenic
1137882502 16:52065963-52065985 CTGGTGTCATAGAATGAGTTAGG + Intronic
1138996574 16:62461051-62461073 CTGGCTTCATAGAATGAGTTTGG + Intergenic
1139173022 16:64653477-64653499 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1140152418 16:72382696-72382718 CTCGTTTCATAGAGTGAGTTTGG - Intergenic
1140949231 16:79800160-79800182 ATGTTTACATAGATCGGGCTTGG - Intergenic
1141211305 16:81982559-81982581 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1202993859 16_KI270728v1_random:36976-36998 CTGGTTTCAAAGAATGAGTTAGG - Intergenic
1203011529 16_KI270728v1_random:245129-245151 CTGGTTTCAAAGAATGAGTTAGG + Intergenic
1203054969 16_KI270728v1_random:916402-916424 CTGGTTTCAAAGAATGAGTTAGG + Intergenic
1142600694 17:1052292-1052314 CTGTCATCATGGATTGATCTCGG + Intronic
1143915342 17:10288031-10288053 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1144155891 17:12501944-12501966 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1144485895 17:15664037-15664059 TTGCTTTCATAGATGGATCTCGG - Intronic
1144701020 17:17339988-17340010 CTGGCTTCATAGAATGAGTTTGG + Intronic
1145027242 17:19477069-19477091 CTGGCCTCATAGAATGAGCTAGG + Intergenic
1145292566 17:21560140-21560162 CTGACTTCATAGATTGAGTTGGG - Intronic
1145387397 17:22425789-22425811 CTGATTTCATAGATTGAGTTGGG + Intergenic
1146249484 17:31326101-31326123 TTGTTTTCATAGACTGTCCTGGG + Exonic
1149021091 17:51965364-51965386 CTGGTTTCATAGAATGAGTCAGG - Intronic
1149133398 17:53336209-53336231 CTGACTTCATAGAATGAGTTAGG + Intergenic
1149152715 17:53588459-53588481 CTGGTTTCATAGAATGAATTAGG - Intergenic
1149940707 17:60862314-60862336 CTGGCTTCATAGAATGAGTTAGG + Intronic
1150022603 17:61633625-61633647 CTGGCTTCATAGAATGAGTTTGG + Intergenic
1150945188 17:69738017-69738039 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1151367465 17:73626728-73626750 CTGTCTTCCTAGAATGTGCTGGG - Intronic
1152054161 17:78009345-78009367 GTGTTTTCATGGATTGAGTGAGG + Intronic
1153350239 18:4072304-4072326 TTTTTTTCATAGATTGAGATTGG + Intronic
1153363666 18:4228327-4228349 CTGATCTCATAGAATGAGGTTGG - Intronic
1153556453 18:6319764-6319786 CTGGTTTCCTAGAATGAGTTAGG - Intronic
1153702418 18:7710032-7710054 CTGGTTTCATAGAATGACTTAGG - Intronic
1154372978 18:13782047-13782069 CTATCTTCATAGAATGAGATGGG - Intergenic
1154448200 18:14451968-14451990 CTGTCTTCATAGAATGAGTATGG + Intergenic
1154527188 18:15304272-15304294 CTGTTTTTATAGATTTGCCTGGG + Intergenic
1155103948 18:22642029-22642051 CTGCTTTTTTAGATTGATCTTGG - Intergenic
1155365660 18:25047031-25047053 ATGTTTTCATCGATTGATATTGG - Intergenic
1155456832 18:26025801-26025823 CTGGTTTCATAGAGTGAGTTGGG - Intronic
1155773893 18:29734854-29734876 CAGTCTTCATAGAATGAGTTAGG + Intergenic
1155899499 18:31371325-31371347 CTGTTTTCAATGAATGTGCTAGG + Intergenic
1156061158 18:33077916-33077938 CTGGCTTCATAGAATGAGTTGGG - Intronic
1156735842 18:40258231-40258253 CTGTTTTCATAGGTTGAAAGAGG + Intergenic
1157062577 18:44309193-44309215 ATGGTTTCATAGAATGAGTTAGG + Intergenic
1157935714 18:51870483-51870505 CTGGTTTCATAGAGTGAGTTAGG + Intergenic
1158210044 18:55038925-55038947 CTCTTTTCTTTTATTGAGCTGGG - Intergenic
1158749437 18:60241931-60241953 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1158830123 18:61267720-61267742 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1158997057 18:62932258-62932280 CTGGTTTCATAGAATGAGTTAGG - Intronic
1159451027 18:68601929-68601951 CTGGTCTCATAGAATGAGTTTGG + Intergenic
1159686034 18:71422035-71422057 CTGATCTCATAGAATGAGTTAGG - Intergenic
1159906895 18:74101042-74101064 CTGGCTTCATAGAATGATCTGGG - Intronic
1160561388 18:79759325-79759347 CTGGTCTCATAGAATGAGCTTGG + Intergenic
1163075220 19:14884760-14884782 CTGGCCTCATAAATTGAGCTGGG - Intergenic
1164148409 19:22527591-22527613 CTCTTTTTCTAGATAGAGCTGGG - Intronic
1164496684 19:28771196-28771218 CTGGTCTCATAGAATGAGTTAGG + Intergenic
1165283989 19:34823047-34823069 CTGTTCTCATAGAATGAGTTAGG - Intergenic
1166176161 19:41072429-41072451 CTGGCTTCATAGAATGAGCTGGG + Intergenic
1167724786 19:51203005-51203027 CTGTGTTCATAGAATGGGTTAGG - Intergenic
1168175189 19:54623168-54623190 TTGGTTTCATAGAATGAGCTAGG + Intronic
1168209183 19:54877104-54877126 CTGGTCTCATAGAATGAGCTGGG + Intronic
1168403091 19:56097351-56097373 CTGGTTAGATAGATTGACCTGGG - Intronic
1202653675 1_KI270707v1_random:29315-29337 CTGGTCTCATAAATTGAGTTAGG - Intergenic
925472540 2:4177800-4177822 CTGGCTTCATAGAATGAGTTAGG + Intergenic
926614389 2:14981164-14981186 GTGTTTTCATTTATTGTGCTGGG - Intergenic
926949950 2:18230765-18230787 CTGGTCTCATAGAATGAGTTGGG - Intronic
926990348 2:18672943-18672965 CTGCCTTCATAGAATGAGTTAGG + Intergenic
928188594 2:29139486-29139508 CTGCTTTCATAGAATGAATTAGG + Intronic
928749176 2:34451798-34451820 CTGGCTTCATAGAATGAGTTTGG + Intergenic
929752312 2:44728424-44728446 CTGGCTTCATAGAATGAGTTAGG + Intronic
930424017 2:51190724-51190746 CTGGCTTCATAGAATGAGTTAGG + Intergenic
930567593 2:53042265-53042287 CTGGTTTCATAGAATGAGTTAGG + Intergenic
930632116 2:53765132-53765154 CTCTTTTTATTGACTGAGCTAGG - Intronic
930764838 2:55074564-55074586 CTGTCTTCATAGAATGATTTAGG - Intronic
930839538 2:55830184-55830206 CTGGACTCATAGAATGAGCTGGG - Intergenic
931095872 2:58940204-58940226 CTGGTTTCATAGAATGAGGTGGG + Intergenic
931536144 2:63279119-63279141 CTGGTTTCATAGAATGATTTAGG - Intronic
931966297 2:67539139-67539161 CTTGTTTCATAGAATGAGTTAGG + Intergenic
932536200 2:72599034-72599056 CTGATTTAATAGAATGAGTTAGG - Intronic
932930076 2:76025183-76025205 CTGATTTCATATAATGAGTTAGG - Intergenic
933080700 2:77981294-77981316 CTGGTCTCATAGAATGAGTTAGG - Intergenic
933433194 2:82211550-82211572 CTGTCTTCATAGACTGATTTAGG + Intergenic
933656298 2:84889683-84889705 CAGTTTTCATATATTCTGCTTGG - Intronic
934127511 2:88912404-88912426 CTGGCTTCATAGAATGAGTTGGG + Intergenic
935481707 2:103597633-103597655 CTGGCTTCATAGAATGAGTTAGG - Intergenic
935491765 2:103729785-103729807 CTGACTTCATAGAATGAGTTAGG - Intergenic
935954308 2:108360371-108360393 CTGTCTTCATAGAATGAATTAGG - Intergenic
936150188 2:110014045-110014067 CTGGTTTTATAGAATGAGTTAGG + Intergenic
936194486 2:110357329-110357351 CTGGTTTTATAGAATGAGTTAGG - Intergenic
936633715 2:114232657-114232679 CTGGTTTCATAGAGTGATTTGGG + Intergenic
937672055 2:124548423-124548445 CTGGTTTCATGGAGTGAACTGGG - Intronic
937683349 2:124668205-124668227 CTGTAGTCATACATTTAGCTAGG + Intronic
937716062 2:125034330-125034352 CTGGCTTCATAGAATGATCTAGG + Intergenic
937874680 2:126813906-126813928 CTGTTTTCATAGAATCAAGTAGG + Intergenic
938315454 2:130323842-130323864 CTGGTCTCATAGAGTGAGTTAGG + Intergenic
938372861 2:130784128-130784150 CTGTTTTAGTAGACTGAGCTAGG - Intergenic
938526281 2:132135750-132135772 CTGTTTTTATAGATTTGCCTGGG + Intergenic
938706492 2:133933340-133933362 TTGATTTCATACATTGATCTTGG + Intergenic
938788661 2:134657095-134657117 CTGGTTTCACAGAATGAGTTAGG + Intronic
939078419 2:137630294-137630316 CTGTTTTTAAAGTTTGAGATTGG - Intronic
939192560 2:138932964-138932986 CTGGTTTCATAAAATGAGCTAGG - Intergenic
939313988 2:140523025-140523047 CTGATTTCATAGAATGAGTTAGG - Intronic
939484284 2:142790468-142790490 CTGATCTCATAGAATGAGTTGGG - Intergenic
940131141 2:150383659-150383681 CTGGCTTCATAGAATGAGTTAGG + Intergenic
940157090 2:150668963-150668985 CTGGTTTCATAGAATGAATTAGG - Intergenic
940611055 2:155992548-155992570 CTGGCTTCATAGAATGAGTTTGG + Intergenic
940620131 2:156102028-156102050 CTGGCTTCATAGAATGAGTTAGG - Intergenic
940674926 2:156715983-156716005 CTGTCTTCATAAAATGAGTTAGG + Intergenic
940706550 2:157111993-157112015 CTGGCTTCATAGAATGAGTTAGG - Intergenic
940716674 2:157233638-157233660 CTGTTTTCATCCATTTTGCTCGG + Intergenic
942197284 2:173533754-173533776 CTGGTTTCATAGGATGAGTTAGG + Intergenic
942386723 2:175450720-175450742 CTGTTTGCAAAGATTTAGATTGG + Intergenic
944377320 2:199061804-199061826 CTGGCCTCATAGAATGAGCTTGG - Intergenic
944378558 2:199077932-199077954 CTGATTTCATAAATTGAGTTTGG - Intergenic
944536001 2:200710456-200710478 CTTTTTTCATAAATTGATTTAGG - Intergenic
944576281 2:201094232-201094254 CTGTTTTTCCAAATTGAGCTTGG - Intergenic
945193054 2:207209940-207209962 CTGGCTTCATAGAATGAGTTAGG - Intergenic
945496637 2:210515203-210515225 CTGGCTTCATAGAATGAGTTAGG + Intronic
945524340 2:210869573-210869595 CTGGTCTCATACAATGAGCTAGG - Intergenic
945608742 2:211971539-211971561 CTGGTCTCATAGAATGAGTTAGG - Intronic
945866142 2:215178196-215178218 CTGGTATCATAGAATGAGTTAGG + Intergenic
946064969 2:216979225-216979247 CTGGCTTCATAAAATGAGCTAGG + Intergenic
946795688 2:223349785-223349807 CTGGCTTCATAGAATGAGTTAGG - Intergenic
947025379 2:225732215-225732237 CTGTATTCAAAGATAGAGGTAGG + Intergenic
947261360 2:228226756-228226778 CTGTTTTAACAGATTGTTCTTGG - Intergenic
948820476 2:240541256-240541278 CTCTCTTCATGGATTGGGCTTGG - Intronic
949054406 2:241918700-241918722 CTGGCCTCATAGAATGAGCTGGG - Intergenic
1168733363 20:107123-107145 CTGGCTTCATAGACTGAGTTAGG - Intergenic
1170302496 20:14900316-14900338 CTGGCTTCATAGAATGAGCTCGG + Intronic
1171098440 20:22356691-22356713 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1171319420 20:24227558-24227580 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1171725325 20:28613638-28613660 CTGTCTTCATAGAATGAGTTTGG + Intergenic
1171747943 20:29017883-29017905 CTGTCCTCATAGAATGAGTTTGG - Intergenic
1171752737 20:29069443-29069465 CTGTCTTCATAGAATGACTTTGG - Intergenic
1171789526 20:29508126-29508148 CTGTCTTCATAGAATGACTTTGG + Intergenic
1171858008 20:30366322-30366344 CTGTCTTCATAGAATGACTTTGG - Intergenic
1172864098 20:38082058-38082080 CTGGCTTCATAGAATGAGTTAGG + Intronic
1175170716 20:57079382-57079404 CTGACCTCATAGAATGAGCTTGG + Intergenic
1175513192 20:59548817-59548839 CTGGCCTCATAGAATGAGCTAGG - Intergenic
1176350494 21:5790987-5791009 CTGTCCTCATAGAATGAGTTGGG + Intergenic
1176357308 21:5911571-5911593 CTGTCCTCATAGAATGAGTTGGG + Intergenic
1176448019 21:6838674-6838696 GTGTCTTCATAGAATGAGTTTGG - Intergenic
1176544815 21:8189057-8189079 CTGTCCTCATAGAATGAGTTGGG + Intergenic
1176563766 21:8372102-8372124 CTGTCCTCATAGAATGAGTTGGG + Intergenic
1176741727 21:10610363-10610385 CTGGCTTCATAGACTGAGTTAGG + Intergenic
1176770251 21:13064236-13064258 CTGTTTTTATAGATTTGCCTGGG - Intergenic
1176826189 21:13703696-13703718 GTGTCTTCATAGAATGAGTTTGG - Intergenic
1176973472 21:15291308-15291330 CTTTTTTCAGAGTTTGAGCTGGG - Intergenic
1177450755 21:21262343-21262365 CTGGTTTAATAGAATGAGTTAGG - Intronic
1177564824 21:22806815-22806837 CTATTTTGATAGATAGAGTTCGG - Intergenic
1177664227 21:24132523-24132545 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1178238168 21:30868053-30868075 CTGTTTTCAAAGAGTGGGTTTGG + Intergenic
1178394311 21:32227691-32227713 CTGGCTTCATAGAATGAGTTGGG - Intergenic
1180028860 21:45187992-45188014 CTGGCATCATAGAGTGAGCTTGG + Intronic
1180409532 22:12591510-12591532 CTGTCTTCATAGAATGAGTTTGG - Intergenic
1180563605 22:16643602-16643624 CTGGCTTCATAGACTGAGTTAGG + Intergenic
1180582566 22:16854323-16854345 CTGGTTTTATAGAATGAGTTAGG - Intergenic
1181503758 22:23336799-23336821 CTGGCTTCATAGAATGAGTTGGG + Intergenic
1181708751 22:24667019-24667041 CTGGCTTCATAGAATGAGTTGGG + Intergenic
1183768555 22:39902561-39902583 CTGCTTTTTTAGATTGAACTTGG + Intronic
1184809384 22:46819742-46819764 CTGGTTTCATAAAATGAGTTAGG + Intronic
1203249685 22_KI270733v1_random:105295-105317 CTGTCCTCATAGAATGAGTTGGG + Intergenic
949196437 3:1314990-1315012 CTTTTTACAAAAATTGAGCTTGG - Intronic
949696536 3:6702896-6702918 CTGGCTTCATAGAGTGAGTTAGG - Intergenic
949749593 3:7336033-7336055 CTGGTTTCATAGAATGATTTAGG - Intronic
949799449 3:7887520-7887542 CTGGTTTCATAGAATGATGTAGG - Intergenic
950842945 3:15985632-15985654 CTGGTTTCATAGAATGAGTTAGG + Intergenic
951268176 3:20594417-20594439 CTGTCTTCATAGAATGATTTAGG + Intergenic
951380093 3:21973052-21973074 CTGATCTCATAGAATGAGTTTGG - Intronic
951470228 3:23048063-23048085 CTGGTCTCATAGAGTGAGTTAGG - Intergenic
951572137 3:24075603-24075625 CTGGCTTCATAGAATGAGTTAGG + Intergenic
952013589 3:28931166-28931188 CTGTTTTCAGACATTGAGCCTGG + Intergenic
952574841 3:34762125-34762147 CTGGCTTCATAGAGTGAGTTAGG - Intergenic
954011225 3:47640715-47640737 CTGGTATCATAGACTGAGGTAGG - Intronic
954502014 3:51026486-51026508 CTGGTTTCATAGAATGAGTTGGG + Intronic
954507133 3:51087111-51087133 CTGGTCTCATAGAATGAGTTAGG - Intronic
954596331 3:51828666-51828688 CTGGCCTCATAGAATGAGCTGGG + Exonic
954633610 3:52059705-52059727 CTGTGCTCAGAGACTGAGCTGGG - Intergenic
956375064 3:68605427-68605449 CTGGTTTCATAAAATGAGTTAGG - Intergenic
956559790 3:70562488-70562510 CTGGTTTCATAGACTGAGTTAGG + Intergenic
956995368 3:74821149-74821171 CTGGTTTCATAGAATGAATTAGG + Intergenic
957006556 3:74955121-74955143 TTGTATTTATAGATTGAACTGGG - Intergenic
957542155 3:81586252-81586274 TTGTTTTCATTTATTGACCTGGG - Intronic
957592734 3:82221780-82221802 CTGGCTTCATAGAATGAGTTAGG + Intergenic
957647361 3:82949292-82949314 ATGTTTTCAGAGATTGATGTGGG - Intergenic
957772604 3:84713722-84713744 CTGGCTTCATAGAATGAGTTAGG - Intergenic
958002567 3:87769731-87769753 CTGGCTTCATAGAATGAGTTAGG + Intergenic
958445673 3:94211587-94211609 CTGGTTTCATAGAATGAATTAGG - Intergenic
958496746 3:94853785-94853807 TAGTGTTCATAGATTGAGATAGG - Intergenic
958591092 3:96158899-96158921 CTGGTCTCATAGAATGAGTTAGG - Intergenic
958815501 3:98910085-98910107 CTGATGTCATAGAATGAGTTAGG - Intergenic
958972358 3:100626014-100626036 CTGGCTTCATAAAATGAGCTAGG + Intronic
959124952 3:102279550-102279572 CTGGCTTCATAGAATGAGTTAGG + Intronic
959222381 3:103537631-103537653 ATGTTTTAATAGATTGTGATTGG - Intergenic
959243167 3:103826376-103826398 CTGGCTTCATAAATTGAGTTAGG - Intergenic
959757135 3:109911996-109912018 CTGGCTTCATAGAATGATCTAGG + Intergenic
960015354 3:112881743-112881765 CTGGTCTCATAGAATGAGTTAGG + Intergenic
960411308 3:117329119-117329141 CTGATCTCATAGAATGAGCTAGG + Intergenic
960524735 3:118696526-118696548 CTGGTTTCATAGAATGAATTAGG - Intergenic
960782831 3:121339033-121339055 CTGGCTTCATAGAATGAGTTAGG - Intronic
960868191 3:122223677-122223699 CTGGGTTCATAGAATGAGTTAGG - Intronic
960929794 3:122835260-122835282 CTGGCTTCATAGAATGAGTTAGG - Intronic
961227628 3:125267198-125267220 CTGGTTTCGTAGAATGAGTTAGG - Intronic
961370769 3:126428754-126428776 CTGGCTTCATAGAATGAGCTTGG + Intronic
961512828 3:127413519-127413541 CTGTTCTCATTTATTGACCTGGG - Intergenic
962289377 3:134119966-134119988 CTGGCTTCATAGAATGAGTTAGG + Intronic
962464579 3:135645652-135645674 CTGGTTTCATAGAATGAGTTAGG + Intergenic
963802633 3:149692098-149692120 CTGACTTCATAGAATGAGTTTGG - Intronic
963929186 3:150984424-150984446 CTGGCTTCATAGAATGAGTTAGG + Intergenic
964057662 3:152481122-152481144 CTGGCTTCATAGAATGAGCTAGG + Intergenic
964162611 3:153663605-153663627 CTGGCTTCATAGAATGAGTTAGG + Intergenic
964456782 3:156877327-156877349 CTGGTTTCATAGAATGATGTAGG + Intronic
964644132 3:158940082-158940104 CTGGTTTCATAGAATGATTTAGG - Intergenic
964951057 3:162293771-162293793 CTGCCTTCATAGAATGAGTTAGG + Intergenic
965023296 3:163263871-163263893 CTGTCCTTATAGAATGAGCTGGG + Intergenic
965147417 3:164924456-164924478 CTTATCTCATAGATTGAGTTAGG + Intergenic
966057910 3:175718481-175718503 CGGTTTTCATAAATTGTTCTTGG + Intronic
966292065 3:178371156-178371178 CTGGTTTCATAGAATGATTTAGG + Intergenic
966340238 3:178917468-178917490 CTGGTTTCATAGAATGACTTAGG - Intergenic
966519703 3:180859848-180859870 TTGGATTCATAGAATGAGCTAGG - Intronic
966707110 3:182928231-182928253 CTGTCTTCACAGAATGAGTTTGG - Intergenic
966991835 3:185240273-185240295 CTGCTTTCATAGAATGATTTAGG + Intronic
967430051 3:189372103-189372125 CTCTTTTCAGAGATTTAGATAGG + Intergenic
967435104 3:189435268-189435290 CTGGCTTCATAGAATGAGTTAGG - Intergenic
967637736 3:191823802-191823824 CTGGCTTCATAGAATGAGTTAGG - Intergenic
967764126 3:193258891-193258913 CTAGTTTCATAGAATGAGTTAGG - Intronic
968537148 4:1140170-1140192 CTGTTCTCATAAAATGAGTTTGG - Intergenic
968580408 4:1388934-1388956 CTGACCTCATAGATTGAGGTGGG + Intergenic
969274466 4:6125404-6125426 CTGTAGCCATAGATGGAGCTGGG - Intronic
969473584 4:7406238-7406260 CTGGCTTCATAGAATGAGTTTGG + Intronic
970184518 4:13435857-13435879 CTGATTTCATAGAATGAGTCAGG - Intronic
970875611 4:20866143-20866165 CTGGCTTCATAGAATGAGTTAGG - Intronic
971044489 4:22790486-22790508 CTGGCTTCATAGAATGAGTTAGG + Intergenic
971099625 4:23450170-23450192 CTGGCTTCATAGAATGAGTTAGG + Intergenic
971182821 4:24346285-24346307 CTGGCTTCATAGAATGAGTTAGG + Intergenic
971364195 4:25964042-25964064 TTGTTTTCACCGATTGTGCTGGG + Intergenic
971900775 4:32655302-32655324 CTGGTTTCATAGAATGAATTAGG + Intergenic
972146617 4:36035090-36035112 CTGGCCTCATAGAATGAGCTGGG + Intronic
972150966 4:36090390-36090412 CTGACTTCATAGAATGAGTTAGG - Intronic
972352553 4:38249933-38249955 CTGATCTCATAGAATGAGCTTGG + Intergenic
972368839 4:38401663-38401685 CTGGCTTCATAGAATGAGTTAGG + Intergenic
972680524 4:41302201-41302223 CTGGTTTCATAGAATGAATTAGG + Intergenic
973007127 4:45023239-45023261 GTGTTTTCATACTGTGAGCTAGG + Intergenic
973271308 4:48265876-48265898 CTGTTTTCATGCATTGTGTTGGG - Intronic
974234563 4:59164410-59164432 CTGGCTTCATAGAATGAGTTAGG - Intergenic
974261124 4:59525319-59525341 CTGGTTTCATAAAATGAGTTAGG + Intergenic
974267260 4:59601747-59601769 CTGGTCTCATAGAATGAGTTTGG - Intergenic
974543650 4:63272145-63272167 CTGCCTTCATAGAATGAGTTAGG + Intergenic
974741226 4:66010711-66010733 CTGGCTTCATAAATTGAGTTAGG + Intergenic
974760693 4:66269871-66269893 CTGGCTTCATAAATTGAGTTAGG - Intergenic
974888896 4:67854901-67854923 CTGGCTTCATAGAATGAGTTGGG - Intronic
975026355 4:69553746-69553768 CTGTCTTCATACAGTGAGTTGGG - Intergenic
975250283 4:72170079-72170101 CCGGTTTCATAGAATGAGTTAGG + Intergenic
975297902 4:72755019-72755041 CTGTGCTCATAGAATGAGCTAGG - Intergenic
975301167 4:72792777-72792799 CTGGTTTCATAGAATGATTTAGG - Intergenic
975898876 4:79126250-79126272 CTGGTCTCATAGAATGAGTTAGG + Intergenic
975899536 4:79135523-79135545 CTGGCTTCATAGAATGAGTTAGG + Intergenic
976368783 4:84262686-84262708 CTGGTTTCATACAATGAGTTAGG - Intergenic
976948167 4:90795997-90796019 CTGGCTTCATAGAATGAGTTAGG + Intronic
977052501 4:92147381-92147403 CAGGTTTCATAGAATGAGTTTGG - Intergenic
977508418 4:97931746-97931768 CTGGTCTCATAGACTGAGTTAGG + Intronic
977719195 4:100219520-100219542 CTGGCCTCATAGATTGAGGTAGG + Intergenic
977813040 4:101380586-101380608 CTGGTTTCATAGAATGGGTTGGG + Intergenic
978263461 4:106792421-106792443 CTGGCTTCATAGAATGAGTTAGG + Intergenic
978391686 4:108233457-108233479 CTGGCCTCATAGAATGAGCTGGG + Intergenic
978678415 4:111347901-111347923 CTGGTTTTATAGAATGAGTTAGG + Intergenic
978911925 4:114074011-114074033 CTGGTTTCACAGAATGAGGTTGG - Intergenic
978917274 4:114142545-114142567 CTGGTTTCATAGAATGATTTAGG + Intergenic
978925840 4:114242625-114242647 CTGGTTTCATAGAATTAGTTAGG + Intergenic
979138326 4:117139231-117139253 CTGGCCTCATAGAATGAGCTCGG - Intergenic
979507114 4:121510903-121510925 CTGGCTTCATAGATTAAGTTAGG - Intergenic
979656499 4:123200614-123200636 CTCTTTTCATTGTTTGAGTTTGG + Intronic
980088088 4:128412711-128412733 CTGGTTTCATAGAATGAGTTAGG + Intergenic
980194953 4:129576774-129576796 CTGGCTTCATAGAATGAGTTAGG + Intergenic
980236823 4:130118551-130118573 CTGGTTTCATAGAATGAGTTAGG - Intergenic
980238143 4:130135161-130135183 CTGTCTTCATAGAATGAATTAGG - Intergenic
980282977 4:130744323-130744345 CTGGCTTCATAGAATGAGTTAGG + Intergenic
980586181 4:134818293-134818315 CTGGCTTCATAGATTGAGTTAGG - Intergenic
980854315 4:138421114-138421136 CAGTCTTAATAGTTTGAGCTTGG + Intergenic
981251247 4:142603852-142603874 CTGTTCTTATAAAATGAGCTAGG - Intronic
981453775 4:144930101-144930123 CTGGTCTCATAGAATGAGTTGGG + Intergenic
981790648 4:148532969-148532991 CTGTCCTCATAGAATGAGTTAGG + Intergenic
981889937 4:149723793-149723815 CTGGCTTCATAGAATGAGTTAGG + Intergenic
982372633 4:154650483-154650505 CTGGTTTCATAAAATGAGTTAGG - Intronic
982960126 4:161825396-161825418 CTGGTTTCATAGAATGATTTAGG + Intronic
983854602 4:172627495-172627517 CTGGCTTCATAGAATGAGTTGGG + Intronic
984722021 4:182981893-182981915 CTGGTTTCATAGAATGAATTAGG - Intergenic
984967554 4:185153419-185153441 CTGGCTTCATAGAATGAGTTGGG - Intergenic
985093201 4:186385070-186385092 CTGGTTTCATAGAATGAATTAGG - Intergenic
985298563 4:188461532-188461554 CTGGTCTCGTAGATTGAGTTTGG - Intergenic
986149751 5:5116807-5116829 CTGGCTTCATAGATTGAGTCAGG + Intergenic
986251613 5:6063628-6063650 CTGGCTCCATAGAATGAGCTAGG - Intergenic
986727300 5:10608574-10608596 ATGTGTTCATATATTGTGCTAGG + Intronic
986857306 5:11885168-11885190 CTGACTTCATAGAATGAGATTGG + Intronic
986899006 5:12408697-12408719 CTGTCCTCATAGAATGAGCTTGG + Intergenic
986906913 5:12505654-12505676 CTGGTCTCATAGAATGAGTTAGG + Intergenic
987146418 5:14995156-14995178 ATGTTTACATGGATTGACCTAGG + Intergenic
987527691 5:19074620-19074642 CTGGTTTCATAGAATGATTTAGG - Intergenic
988177785 5:27749214-27749236 CTGATTCCATAAATTGTGCTGGG + Intergenic
988195510 5:28000359-28000381 CTGGCTTCATAGAATGAGTTAGG + Intergenic
988287883 5:29244810-29244832 CTGGCTTCATAGAATGAGTTAGG - Intergenic
988362357 5:30253036-30253058 CTGGTTTCATAGAATGAGGGAGG + Intergenic
988876205 5:35449140-35449162 CTGTCTTCATAGAATGATTTAGG - Intergenic
989608300 5:43266954-43266976 CTGGCTTCATAGAATGAGTTTGG + Intronic
990167822 5:53014603-53014625 CTGGCTTCATAGAATGAGTTAGG + Intronic
990903065 5:60774120-60774142 CTGGTTTCATAGAATGAGTTAGG - Intronic
990922914 5:60987413-60987435 CTGGTTTCATAGAATGAGTTGGG - Intronic
991211701 5:64112845-64112867 CTGGTCTCATAGAATGAGTTGGG - Intergenic
991281583 5:64920477-64920499 CTGGCTTCATAGAATGAGTTAGG + Intronic
991627064 5:68614197-68614219 CTGGTCTCATAGAATGAGCTAGG - Intergenic
992276220 5:75122414-75122436 CTGGCTTCATGGAATGAGCTAGG - Intronic
992291305 5:75282824-75282846 CTGTTTTCATGCAGTGAGCTGGG + Intergenic
992533601 5:77675230-77675252 CTGCCTTCATAGAATGAGTTGGG - Intergenic
993250044 5:85510110-85510132 CTGTTTTCATAGAATGAATTAGG + Intergenic
993284202 5:85969175-85969197 CTAGTTTCATAGAATGAGTTAGG + Intergenic
993350972 5:86849910-86849932 CTGGTCTCATAGAATGAGTTGGG + Intergenic
993454912 5:88116584-88116606 CTCTTTTCTTAGAATGTGCTGGG - Intergenic
993833822 5:92791629-92791651 CTGGCCTCATAGAATGAGCTGGG + Intergenic
994129408 5:96207801-96207823 CTGGCTTTATAGAATGAGCTGGG + Intergenic
994277069 5:97851967-97851989 CTGGTTTCATAGAATGATTTAGG - Intergenic
994512068 5:100716926-100716948 CTGGTCTCATAGAATGAGTTAGG + Intergenic
994596044 5:101836420-101836442 CTGGTTTCATAAAATGAGTTAGG + Intergenic
994770695 5:103977803-103977825 CTGGTCTCATAGAATGAGTTGGG - Intergenic
994777844 5:104057831-104057853 CTGGTTTCATAGAATGATTTAGG + Intergenic
995455860 5:112351600-112351622 CTGGCTTCATAGACTGAGTTAGG - Intronic
995696757 5:114886806-114886828 CTGGCTTCATAGAGTGGGCTAGG + Intergenic
995777654 5:115742051-115742073 CTGGTCTCATAGAATGAGTTTGG + Intergenic
995788558 5:115858497-115858519 CTGTTTTCATTAGTTGTGCTGGG + Intronic
996469231 5:123840498-123840520 CTGACTTCCTAGAATGAGCTGGG - Intergenic
996473798 5:123891773-123891795 CTGGCTTCATAGAATGAGTTTGG - Intergenic
996515539 5:124365507-124365529 CTCTTTTCATATATGGAGCAGGG - Intergenic
996925214 5:128817280-128817302 CTGTTTTCATAGATTGAATTGGG - Intronic
997085311 5:130790196-130790218 CTGGCCTCATAGAATGAGCTTGG - Intergenic
997804368 5:136900602-136900624 CTGTCTTCATAAAATGAGCTCGG + Intergenic
998573357 5:143285914-143285936 ATGTTTTCATAGAACCAGCTTGG - Intronic
998650963 5:144121023-144121045 CTGGCCTCATAGAATGAGCTGGG + Intergenic
999352379 5:150886404-150886426 CTGTTTTTATAGAATGAATTGGG + Intronic
999575208 5:152968766-152968788 CTGGATTCATAGAATGAGTTAGG - Intergenic
999819044 5:155206499-155206521 CTGGTTTCATAGAATGAATTAGG - Intergenic
1000034455 5:157434033-157434055 CTGGCTTCATAGAATGAGTTAGG - Intronic
1000859725 5:166442131-166442153 CTGGCTTCATAGAATAAGCTAGG + Intergenic
1001607941 5:172976763-172976785 CTGTTTTCAGTGACAGAGCTTGG - Intergenic
1002814196 6:663424-663446 CTGGTTTCATAGAATGAATTAGG - Intronic
1002967531 6:1981657-1981679 CTGGTTTCATAGAATGAGTTAGG - Intronic
1003249085 6:4409373-4409395 CTGGTTTCATAAAATGAGTTAGG - Intergenic
1003438419 6:6116693-6116715 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1003978575 6:11367751-11367773 CTGCTGTCAATGATTGAGCTAGG - Intronic
1004013489 6:11711231-11711253 CTGTTTCTATGGATTAAGCTGGG - Intergenic
1004095354 6:12548778-12548800 CTGTTTTCACAAAATGAGCTTGG + Intergenic
1004103103 6:12635401-12635423 CTGGTTTCATAAAATGAGTTAGG + Intergenic
1004793476 6:19054947-19054969 CTGGTTTCATAGAATAAGTTAGG - Intergenic
1004888833 6:20078069-20078091 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1005036986 6:21564968-21564990 CTGGCTTCATAGAATGAGTTTGG + Intergenic
1005222629 6:23605224-23605246 CTGTTCTCATAGAATGAGTTTGG - Intergenic
1005259190 6:24039356-24039378 CTGGTTTCATAGAATGATTTAGG + Intergenic
1005459815 6:26057126-26057148 CTCTTTTCATAGATGGGGGTGGG + Intergenic
1005919368 6:30385799-30385821 CTGTCTTCATAGAATGATTTAGG - Intergenic
1006086670 6:31600575-31600597 CTGTTTTCATGGTCTGAGTTGGG - Intergenic
1007216064 6:40239188-40239210 CTGGCTTTATAGAATGAGCTGGG - Intergenic
1007440037 6:41851128-41851150 CTGGCATCATAGAATGAGCTTGG - Intronic
1007526343 6:42497559-42497581 CTGGTTTCATAGAATGATTTAGG + Intergenic
1007874617 6:45082276-45082298 CTAGTTTCATAGAATGAGTTAGG - Intronic
1008021141 6:46578949-46578971 CTGTCCTCATAGAATGAGTTAGG - Intronic
1008325073 6:50168881-50168903 CTCTCTTCATAGAATGAGTTTGG - Intergenic
1008334460 6:50284719-50284741 CTGTTCTCATAGAATGAGCTAGG - Intergenic
1009034639 6:58101779-58101801 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1009045619 6:58234156-58234178 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1009221437 6:60988476-60988498 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1009325355 6:62342359-62342381 CTGGCTTTATAGAATGAGCTGGG - Intergenic
1009329375 6:62397356-62397378 CTGGTTTCCTAGAATGAGTTTGG + Intergenic
1009332228 6:62438046-62438068 CTGGTTTCATAGAATGATTTAGG + Intergenic
1009805193 6:68593248-68593270 CTGCTTACATAGAATGAGTTAGG + Intergenic
1010061826 6:71631723-71631745 CTGGTCTCATAGAATGAGTTTGG + Intergenic
1010402720 6:75465290-75465312 CAGTTTTCATAAATTGTTCTTGG - Intronic
1010459274 6:76095444-76095466 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1010491404 6:76480633-76480655 CTCGTTTCATAGAATGAGTTAGG - Intergenic
1010576502 6:77538472-77538494 CTGTCTTCATAAAATGAGTTAGG - Intergenic
1010862780 6:80934284-80934306 CTGGTTTCACAGATTGATTTAGG + Intergenic
1010920779 6:81677714-81677736 GTGGTTTCATAGAATGAGTTAGG - Intronic
1010988766 6:82455889-82455911 CTGTCTTTGTAGAATGAGCTAGG + Intergenic
1011036633 6:82984008-82984030 CTGATTTCATAGATTTGACTTGG - Intronic
1011092953 6:83627355-83627377 CTGGTTTCACAGAATGAGTTAGG + Intronic
1011138178 6:84122201-84122223 CTGTATTTATAGAATGAGTTTGG - Intergenic
1011250613 6:85368048-85368070 CTGTTCTCATAAAATGAGTTAGG - Intergenic
1011321666 6:86101444-86101466 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1011324362 6:86133011-86133033 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1011538599 6:88405752-88405774 CTCTTTTCATTGATTCTGCTTGG - Intergenic
1011571065 6:88736309-88736331 ATGTTCTCATAGAATGAGTTAGG - Intronic
1011694868 6:89903071-89903093 CTGGTCTCATAGAATGAGTTAGG + Intergenic
1011970551 6:93217341-93217363 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1012665076 6:101959031-101959053 CTGGCTTCATAGAATGAGTTAGG + Intronic
1012810655 6:103953074-103953096 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1012830087 6:104193492-104193514 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1012995804 6:105972817-105972839 CTGGTCTCATAGAATGAGCTTGG + Intergenic
1013081017 6:106813075-106813097 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1013508479 6:110822539-110822561 CTGGCTTCATAGAATGAGTTGGG - Intronic
1013568637 6:111396495-111396517 CTGGCTTCATAGAATGAGTTAGG + Intronic
1013937965 6:115621872-115621894 CTGGTTTCATAGAATGAGTTAGG - Intergenic
1014375532 6:120667780-120667802 CTGGTCTCATAGAATGAGTTAGG + Intergenic
1014855255 6:126392800-126392822 CTGGTCTCATAGAATGAGTTTGG + Intergenic
1015131037 6:129809526-129809548 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1015362077 6:132351646-132351668 CTGGTTTCATAGAATGAATTAGG + Intronic
1015521795 6:134139113-134139135 CTATTTTAAAAGATTGGGCTGGG + Intergenic
1016077007 6:139807611-139807633 TTGGTTTCATAAAATGAGCTGGG + Intergenic
1016304354 6:142667984-142668006 ATGTTTAGATAGATTGATCTTGG - Intergenic
1017567451 6:155702787-155702809 CTGGTTTCATACACTGAGTTAGG + Intergenic
1017885082 6:158592347-158592369 CAATTTTCATAGATTGGGCCGGG + Intronic
1018091873 6:160352648-160352670 CAGTTTTTATAGATTCAGCCAGG - Intronic
1018526597 6:164717628-164717650 CTAGTTTCATAGAATGAGTTAGG - Intergenic
1018656167 6:166038516-166038538 CTGATTTCATAGAATGATTTAGG + Intergenic
1019001819 6:168760070-168760092 CTGACTTCATAGAATGAGTTAGG - Intergenic
1019031286 6:169015176-169015198 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1019874976 7:3801954-3801976 CTGCTTTCATGGATTGAGTAGGG + Intronic
1019940862 7:4289142-4289164 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1020450715 7:8317623-8317645 ATGTTTTCATAAATTGAGAGAGG - Intergenic
1020541847 7:9468562-9468584 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1020574481 7:9908766-9908788 CTGGCTTCATAGAATGAGTTTGG + Intergenic
1020592136 7:10153238-10153260 CTTGTTTCATAGAATGAGTTAGG - Intergenic
1020619458 7:10500402-10500424 CTGTTGTCATAAAATGAGTTAGG - Intergenic
1020871341 7:13632943-13632965 CTGGCTTCATAGAATGAGATAGG - Intergenic
1020993219 7:15228760-15228782 TTGTTTTGATAGATTCAGCCAGG + Intronic
1021544243 7:21795356-21795378 CTGTTCTCCTAGATCAAGCTTGG + Intronic
1022878082 7:34556169-34556191 CTGTCCTCATAGAATGAGTTGGG - Intergenic
1023195280 7:37630952-37630974 CTGATCTCATAGAATGAGTTTGG + Intergenic
1023484275 7:40667450-40667472 CTGGCTTCATAGAATGAGTTAGG + Intronic
1023916740 7:44595533-44595555 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1024368752 7:48555335-48555357 CTGGCCTCATAGATTGAGTTTGG + Intronic
1024496213 7:50049302-50049324 CTGGCTTCATAGAATGCGCTGGG - Intronic
1024497081 7:50060798-50060820 CTGGCCTCATAGAATGAGCTAGG - Intronic
1024726185 7:52198584-52198606 CTGGTTCCATAGATTGAGTTAGG + Intergenic
1024842859 7:53607077-53607099 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1025590815 7:62858516-62858538 CTGTTTTCATAGAATCTGCAAGG + Intergenic
1026581294 7:71620293-71620315 CTGGTTTCATAGAATGAGTTAGG + Intronic
1026882115 7:73913779-73913801 CTGGCTTCATAGAATGAGTTGGG + Intergenic
1027415668 7:77971842-77971864 CTGGTTTCATAAAATGAGTTGGG + Intergenic
1027495475 7:78882499-78882521 CTGGCTTCATAGAATGAGTTAGG - Intronic
1027506577 7:79022973-79022995 CTGCCTTCATAGAATGAGTTAGG - Intronic
1027524477 7:79249784-79249806 CTGTCCTCATAGAATGAGTTTGG - Intronic
1027626870 7:80556032-80556054 CTGGCTTCATAGAATGAGTTAGG + Intronic
1027673031 7:81125902-81125924 CCAGTTTCATAGAATGAGCTGGG + Intergenic
1028019024 7:85748227-85748249 CTGTTTTTGTAGAATGAGTTAGG - Intergenic
1028041016 7:86054681-86054703 TTGCTTTCATAGAATGAGTTAGG + Intergenic
1028279636 7:88905766-88905788 CTGGCTTCATAGAATGAGTTAGG + Intronic
1028293951 7:89104238-89104260 CTGGATTCATAGAATGAGTTAGG + Intronic
1028412141 7:90541439-90541461 CTGTTTTCATGGAATGAATTTGG - Intronic
1028529364 7:91821453-91821475 CTGGCTTCATAGAATGAGTTAGG + Intronic
1028543158 7:91967804-91967826 TTGGTTTCATAGAATGAGTTTGG + Intronic
1028575449 7:92344586-92344608 CTGTTTTCATAGATTTTGAAGGG + Intronic
1029840532 7:103358325-103358347 CTGTTTTCATCCATTGTCCTGGG + Intronic
1029862284 7:103585696-103585718 CTGGTTTTATAGATTGAGTTAGG - Intronic
1030134123 7:106230167-106230189 CTGGCTTCATAGAATGAGTTGGG + Intergenic
1030495844 7:110299017-110299039 CTGTTATTTTGGATTGAGCTTGG - Intergenic
1030531297 7:110714451-110714473 CTGGTTTCATAGAATGAGTTAGG + Intronic
1030718737 7:112843779-112843801 CTGGCTTCATAGAATGAGGTGGG - Intronic
1030721161 7:112872112-112872134 CTGGTTTCATAGAATGAGTTAGG - Intronic
1030752846 7:113252159-113252181 CTGGCTTCATAGAGTGAGTTTGG - Intergenic
1030768165 7:113438100-113438122 CTGTCTTCATAGAATGAGTTAGG + Intergenic
1031139171 7:117922498-117922520 CTGGTTTCATAGAATGATTTAGG - Intergenic
1031547168 7:123065011-123065033 CTGCCCTCATAGAATGAGCTGGG + Intergenic
1031811085 7:126369783-126369805 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1032138327 7:129302857-129302879 CTGGTCTCATAGAATGAGTTTGG + Intronic
1032290336 7:130583948-130583970 CTGGCTTCATAGAATGAGTTCGG - Intronic
1032364211 7:131284325-131284347 CTATTTTCATAGATTCTGATAGG + Intronic
1032775304 7:135106718-135106740 CTGGCTTCATAGAATGAGTTGGG + Intronic
1032866343 7:135929006-135929028 CTGTTTGAATGGATTGACCTTGG - Exonic
1032911982 7:136443014-136443036 CTGGCTTCATAGATTGATTTAGG - Intergenic
1033259961 7:139834954-139834976 CTGGCTTCATAGAATGAGTTAGG - Intronic
1033268229 7:139905621-139905643 CTGGCTTCATAGAATGAGTTAGG + Intronic
1033496315 7:141900176-141900198 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1033709079 7:143920028-143920050 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1033782534 7:144689578-144689600 CAATATTCATAGTTTGAGCTAGG + Intronic
1034205871 7:149314698-149314720 CTGTTTTCATAGAATGAGTTAGG + Intergenic
1034216525 7:149411338-149411360 CTGGCCTCATAGAATGAGCTAGG + Intergenic
1034708235 7:153166715-153166737 CTGGTTTAATAGAATGAGTTAGG + Intergenic
1035910859 8:3564821-3564843 CTTTTTTCATAAACTGAGTTTGG - Intronic
1036695636 8:10973169-10973191 CTATTTTGAAAGAGTGAGCTTGG + Intronic
1036991702 8:13605449-13605471 GTGTTTTCATAGAATCAGCGAGG - Intergenic
1037067742 8:14603000-14603022 ATGTTTTCCTAGATTAAGCATGG - Intronic
1037398207 8:18465905-18465927 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1037488169 8:19369341-19369363 CTGACTTCATAGAATGAGTTAGG + Intronic
1038074814 8:24060010-24060032 GTGTTCTCATAGAATGAGTTTGG - Intergenic
1038494040 8:27989435-27989457 CTATTTTCATGACTTGAGCTTGG + Intronic
1038708255 8:29916720-29916742 CTGTCTTCATAGAATAAGTTAGG - Intergenic
1038990589 8:32863251-32863273 CTGGCCTCATAGAATGAGCTAGG - Intergenic
1039033872 8:33337986-33338008 CTGGCTTCATAGAATGAGTTTGG - Intergenic
1039678732 8:39704193-39704215 CTGTCCTCATAGAATGAGTTAGG - Intronic
1040617445 8:49051698-49051720 CTGCTTTCATAGAATGAGGTAGG + Intergenic
1040790260 8:51220405-51220427 CTGGTTTCATAGAATGAGTTGGG - Intergenic
1041334577 8:56766544-56766566 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1042140828 8:65677022-65677044 CAGTTTTCATAGATAAAGCATGG + Intronic
1042489841 8:69384677-69384699 CTGCCTTCATAGAATGAGCTAGG - Intergenic
1042609336 8:70580191-70580213 CTGGCTTCATAGAATGAACTGGG - Intronic
1042763381 8:72294756-72294778 CTGGTTTCATAAAATGAGTTAGG - Intergenic
1043093160 8:75929802-75929824 CTGTCCTCATAGAATGAGTTAGG - Intergenic
1043235978 8:77867499-77867521 CTGGTTTCATAAAATGAGTTAGG - Intergenic
1043311693 8:78868049-78868071 CTGTCCTCATAGAATGAGTTTGG + Intergenic
1043666155 8:82817057-82817079 CTGGTATCATAGAATGAGTTTGG + Intergenic
1044078202 8:87849744-87849766 CTGGTTTCATAGAATGAGTTCGG - Intergenic
1044228440 8:89745999-89746021 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1044228694 8:89749327-89749349 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1044272169 8:90258966-90258988 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1044879582 8:96709887-96709909 CTGGCTTCATAGAATGAGTTAGG + Intronic
1044903613 8:96975464-96975486 CTGGCTTCATAGAATGAGTTAGG - Intronic
1045301358 8:100913386-100913408 ATGTTTTCTTAGTTTGAGCTGGG + Intergenic
1045312519 8:101015453-101015475 CTGTTTTCTTACACTGTGCTGGG - Intergenic
1045601999 8:103727823-103727845 CTGTTTTCATTGCTATAGCTTGG + Intronic
1045611990 8:103854869-103854891 CTGATTTCATAGAATAAGTTAGG + Intronic
1045612582 8:103863450-103863472 CTGGCTTCATAGAATGAGTTAGG + Intronic
1045991117 8:108309633-108309655 CTGGCCTCATAGAATGAGCTTGG - Intronic
1046073339 8:109285301-109285323 CTGCCTTCATAGAGTGAGTTAGG - Intronic
1046297559 8:112241260-112241282 ATGTTTTTATTGATTGTGCTAGG + Intronic
1046449290 8:114367078-114367100 CTGGCTTCATAGAATGAGGTTGG - Intergenic
1048561330 8:135540807-135540829 CTGTTTTCATACATGGGACTTGG - Intronic
1048640678 8:136356509-136356531 CTGATTTCATAGAGTGAGTTTGG + Intergenic
1050079468 9:1900916-1900938 CTGGTTTCTTAGAATGAGTTAGG - Intergenic
1050177818 9:2886674-2886696 CTGTTGTCCAAGATTGTGCTTGG - Intergenic
1050356440 9:4787908-4787930 CTGATCTCATAGAATGAGTTTGG - Intergenic
1050404815 9:5296658-5296680 CTGTCTTCATAAAATGAGTTAGG - Intergenic
1050408322 9:5333655-5333677 CTGTCCTCATAGAATGAGTTAGG - Intergenic
1050414755 9:5404261-5404283 CTGTCCTCATAGAATGAGTTAGG - Intronic
1050618182 9:7425243-7425265 TTGGTCTCATAGAATGAGCTTGG + Intergenic
1050634302 9:7594367-7594389 CTGATCTCATAGAATGAGTTGGG + Intergenic
1050841552 9:10155950-10155972 CTGGCTTCATAGAATGAGTTAGG + Intronic
1050980148 9:12000429-12000451 CTGTTCTCATAGGATGAGTTTGG - Intergenic
1050986376 9:12088465-12088487 CTGACTTCATAGAATGAGTTAGG + Intergenic
1051684609 9:19644647-19644669 CTGTTTTCCTCGCTTGACCTTGG + Intronic
1052250472 9:26391675-26391697 CGGGTTTCATAGAATGAGTTAGG + Intergenic
1052261728 9:26524658-26524680 CTGTTTTCATAGACTGGAATGGG - Intergenic
1052405002 9:28048262-28048284 CTGTATTTATAGATTTAGTTGGG - Intronic
1052612510 9:30793853-30793875 CTGATTACACATATTGAGCTAGG - Intergenic
1052618974 9:30880654-30880676 CTGGCCTCATAGAATGAGCTAGG + Intergenic
1052873198 9:33528524-33528546 CTATTTGGATAGAATGAGCTTGG - Intronic
1052973130 9:34390951-34390973 CTGGGTTCATAGAATGAGTTAGG + Intronic
1053502903 9:38616225-38616247 CTATTTGGATAGAATGAGCTTGG + Intergenic
1053582639 9:39422956-39422978 CTAATTTCATAGAATGAGGTAGG + Intergenic
1053754514 9:41291227-41291249 GTGTTTTCATACTATGAGCTTGG + Intergenic
1053846821 9:42247801-42247823 CTAATTTCATAGAATGAGGTAGG + Intergenic
1054104218 9:60981699-60981721 CTAATTTCATAGAATGAGGTAGG + Intergenic
1054260033 9:62855563-62855585 GTGTTTTCATACTATGAGCTGGG + Intergenic
1054331739 9:63764447-63764469 GTGTTTTCATACTATGAGCTGGG - Intergenic
1054342694 9:63880690-63880712 CTGCTTCCATCGAATGAGCTTGG + Intergenic
1054582126 9:66925151-66925173 CTAATTTCATAGAATGAGGTAGG - Intronic
1055125049 9:72709367-72709389 CTGGTTTCATAGAATGATTTAGG + Intronic
1055156598 9:73070194-73070216 CTGGTTTCATAGAATGATTTAGG - Intronic
1055246258 9:74247456-74247478 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1055253846 9:74342878-74342900 TTGGCTTCATAGAATGAGCTGGG - Intergenic
1055486028 9:76757264-76757286 CTGGTTTCATTGAATGAGGTGGG - Intronic
1055653142 9:78427214-78427236 CTGGCCTCATAGATTGAGTTAGG + Intergenic
1055675861 9:78659989-78660011 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1055732736 9:79295534-79295556 CTGGTTTCACAGTTTTAGCTTGG - Intergenic
1055875336 9:80935273-80935295 CTATTTTCATATGTTGAGTTTGG - Intergenic
1055911174 9:81353857-81353879 CTGTCTTCATAGAATGAATTAGG + Intergenic
1056033332 9:82577471-82577493 CTGACTTCATAGAATGAGTTAGG - Intergenic
1056971075 9:91204052-91204074 CTGATTTCATAGAATGATTTAGG - Intergenic
1057119129 9:92555072-92555094 CTGGCTTCATAGAATGAGTTAGG + Intronic
1057340152 9:94193477-94193499 CCGGTTTCATAGAATGAGTTAGG + Intergenic
1057718777 9:97516274-97516296 CTGTGTTCCCAGATTGAGCCGGG - Intronic
1058302620 9:103395121-103395143 TTGGTTTCATAGAATGAGTTAGG + Intergenic
1058916497 9:109571617-109571639 CTGACTTCATAGAATGAGGTAGG - Intergenic
1059630574 9:116117454-116117476 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1059807588 9:117820052-117820074 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1060383528 9:123200421-123200443 CTGGTTTCACAGAATGATCTAGG + Intronic
1060443286 9:123662046-123662068 CTGTTTTCATCTATTGTGCTGGG - Intronic
1062709001 9:137961884-137961906 CTGGTCTCATAGAATGAGTTAGG + Intronic
1202799118 9_KI270719v1_random:157577-157599 ATGTTTTCATACTATGAGCTGGG - Intergenic
1203521171 Un_GL000213v1:45844-45866 GTGTCTTCATAGAATGAGTTTGG + Intergenic
1203450537 Un_GL000219v1:110422-110444 CTGTCTTCATAGAATGAGTTTGG + Intergenic
1203466080 Un_GL000220v1:88557-88579 CTGTCCTCATAGAATGAGTTGGG + Intergenic
1187115287 X:16343339-16343361 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1187310860 X:18141068-18141090 CTGACTTCATAGAATGAGTTAGG - Intergenic
1187375812 X:18753005-18753027 CTGATCTCATAGAGTGAGTTAGG + Intronic
1187637394 X:21245287-21245309 CTGGTTTCATAGAATGAGTTAGG + Intergenic
1187801801 X:23071926-23071948 CTGTCCTCATAGAATGAGTTAGG - Intergenic
1188119771 X:26289987-26290009 CTGGTTTCATAGAATGAATTAGG + Intergenic
1188148893 X:26648522-26648544 CTGGCTTCATCGATTGAGTTAGG + Intergenic
1188319296 X:28715817-28715839 CTGGTCTCATAGAATGAGTTAGG - Intronic
1188325070 X:28791985-28792007 CTGGTTTTATAGGTTGGGCTGGG - Intronic
1188406461 X:29816562-29816584 CTGGTTTCATAGAATGAGTTAGG - Intronic
1188663841 X:32793880-32793902 CTGGCTTCATAGAATGAGATAGG - Intronic
1188771128 X:34156026-34156048 CTGGTCTCATAGAATGAGTTGGG + Intergenic
1188853897 X:35168057-35168079 CTGGCTTCATAGAATGAGTTTGG + Intergenic
1189641312 X:43074816-43074838 CTGTTCTCATAAAATGAGTTTGG + Intergenic
1189873860 X:45413932-45413954 CTGTTCTCATAGAATCAGTTTGG + Intergenic
1189878247 X:45459920-45459942 CTGGTTTTATAGAATGAGTTAGG + Intergenic
1189887257 X:45560657-45560679 CTGGTTTCATAAAGTGAGTTAGG + Intergenic
1190231792 X:48587845-48587867 CTGTTCTCATAAAATGAGTTTGG + Intergenic
1190532153 X:51389700-51389722 CTGACTTCATAGAATGAGTTTGG - Intergenic
1190615945 X:52232008-52232030 CTGGTCTCATAGAATGAGTTGGG - Intergenic
1190631895 X:52395706-52395728 CTGGTTTCATAGAATGATTTAGG + Intergenic
1190972128 X:55360136-55360158 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1191061772 X:56305675-56305697 CTGGCTTCATAGAATGAGTTTGG + Intergenic
1191067414 X:56364941-56364963 CTGGTTTCATAGAATGAATTAGG + Intergenic
1191202667 X:57801485-57801507 CTGGTTTCATAGAATGAATTAGG - Intergenic
1191603642 X:63038758-63038780 CTGTTTTTATAGAATGAGTTAGG + Intergenic
1191729906 X:64322409-64322431 CTGTTTTTATAGAATGAGTTTGG + Intronic
1191749343 X:64524610-64524632 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1191758048 X:64615845-64615867 CTGATCTCATAGAATGAGCTTGG + Intergenic
1191823950 X:65343312-65343334 CTGTCCTCATAGAATGAGTTAGG - Intergenic
1191980722 X:66922205-66922227 CTGGTCTCATAGAATGAGTTGGG + Intergenic
1192061166 X:67828161-67828183 CTGGTTTCATAGAATGAAATAGG - Intergenic
1192188167 X:68970676-68970698 CTGTTCTCATAAAATGAGCTTGG - Intergenic
1192463107 X:71334934-71334956 CTGACCTCATAGAATGAGCTAGG + Intergenic
1192596925 X:72420104-72420126 CTGATCTCATAGAATGAGCTGGG + Intronic
1192696786 X:73424909-73424931 CTGGATTCATAGAATGAGTTGGG - Intergenic
1192726507 X:73758869-73758891 CTGTCCTCATAGAATGAGTTAGG + Intergenic
1192870860 X:75182361-75182383 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1192904041 X:75530638-75530660 CTGGTTTCATAGAATGAATTAGG + Intergenic
1192920914 X:75705118-75705140 CTGGTCTCATAGAATGAGATGGG - Intergenic
1193107953 X:77699915-77699937 CTGTTTTCATAAAATGAGTTGGG - Intronic
1193120031 X:77813562-77813584 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1193196205 X:78634440-78634462 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1193197209 X:78646782-78646804 CTGGTTTCATAGAATGACTTAGG - Intergenic
1193237033 X:79119992-79120014 CCGATTTCATAGAATGAGTTGGG + Intergenic
1193282202 X:79666329-79666351 CTGGCTTCATAGAATGAGGTAGG - Intergenic
1193382568 X:80832838-80832860 CTGGCTTCATAGAATGAGTTTGG - Intergenic
1193385367 X:80864958-80864980 CTGATCTCATAGAATGAGTTAGG + Intergenic
1193391401 X:80932990-80933012 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1193403773 X:81077724-81077746 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1193422876 X:81305288-81305310 CTGACTTCATAGAATGAGATAGG + Intergenic
1193526841 X:82601163-82601185 CTGGATTCATAGAATGAGTTTGG + Intergenic
1193662352 X:84272858-84272880 CTGTCTTCATAGAATGATTTAGG - Intergenic
1193723322 X:85012848-85012870 CTGGCTTCATAGAATGATCTAGG + Intronic
1193767864 X:85553570-85553592 CTGGTGTCATAGAATGAGTTTGG + Intergenic
1193775696 X:85638738-85638760 CTGGTTTCATAGAATGATTTAGG + Intergenic
1193830600 X:86284607-86284629 CTGGTTTCATAGAATGAGTTTGG + Intronic
1193952523 X:87818100-87818122 CTGGTTCCATAGATTAAGTTAGG - Intergenic
1193991366 X:88311973-88311995 CTGGTCTCATAGAATGAGTTAGG - Intergenic
1194067553 X:89280914-89280936 CTGGTTTCATAGAATGAGTTAGG - Intergenic
1194196436 X:90899486-90899508 CTGTCTTCATAGAATAAGTTTGG + Intergenic
1194354127 X:92859839-92859861 CTGGCTTCATAGAATGATCTAGG - Intergenic
1194442744 X:93953294-93953316 CTGGTTTAATAGAGTGAGTTAGG + Intergenic
1194920274 X:99757470-99757492 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1195103729 X:101582537-101582559 CTGTCCTCATAAAATGAGCTAGG + Intergenic
1195142380 X:101975204-101975226 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1195160972 X:102171037-102171059 CTGGCCTCATAGAATGAGCTAGG + Intergenic
1195214040 X:102679703-102679725 GTGTCTTCATAGAATGAGTTAGG + Intergenic
1195224243 X:102776228-102776250 CTGTCCTCATAGAATGAGTTTGG + Intergenic
1195241302 X:102955231-102955253 CTGGTCTCATAGAATGAGTTAGG + Intergenic
1195473142 X:105256151-105256173 CTGGTTTCATAGAATGAGTTGGG + Intronic
1195548740 X:106142252-106142274 CTGGCTTCATAGAATGAGTTGGG - Intergenic
1195919604 X:109970558-109970580 CTTTTCTCATAGAATGAGCTTGG + Intergenic
1196219191 X:113091540-113091562 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1196730027 X:118931685-118931707 CTGTCCTCATAGAATGAGTTAGG + Intergenic
1196980013 X:121202448-121202470 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1197260910 X:124316781-124316803 CTGACCTCATAGAATGAGCTTGG - Intronic
1197589186 X:128387427-128387449 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1198410878 X:136366462-136366484 CTGTATTCGTAGTTAGAGCTTGG - Intronic
1198775879 X:140178555-140178577 CTGTTTTCAAAGATGGGGCGGGG - Intergenic
1198803775 X:140473932-140473954 CTGGCCTCATAGATTGAGTTGGG - Intergenic
1198958165 X:142155230-142155252 CTGGTCTCATAGAATGAGTTAGG + Intergenic
1198976014 X:142336875-142336897 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1199052647 X:143254965-143254987 CTGGCTTCATAGAATGAGTTAGG - Intergenic
1199113565 X:143962403-143962425 CTGGTCTCATAGAATGAGTTAGG + Intergenic
1199407729 X:147482389-147482411 CTGGCTTCATAGAATGAGTTAGG + Intergenic
1200421875 Y:2978470-2978492 CTGTTTGCATATATTTGGCTTGG + Intronic
1200422957 Y:2991490-2991512 ATGGCTTCATAGAATGAGCTAGG + Intergenic
1200542280 Y:4473686-4473708 CTGTCTTCATAGAATAAGTTTGG + Intergenic
1200662481 Y:5976860-5976882 CTGGCTTCATAGAATGATCTAGG - Intergenic
1200721705 Y:6615105-6615127 CTGGTTTCATAGAATGAGTTAGG - Intergenic
1201349279 Y:13021854-13021876 TTGGTTTCATAGAATGAGTTGGG + Intergenic
1202600053 Y:26584561-26584583 CTGGCTTCATAGACTGAGTTAGG + Intergenic