ID: 1090008011

View in Genome Browser
Species Human (GRCh38)
Location 11:123019509-123019531
Sequence GTGGTTTAGGAGGTAAACAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090008011_1090008015 16 Left 1090008011 11:123019509-123019531 CCTCTGTTTACCTCCTAAACCAC No data
Right 1090008015 11:123019548-123019570 CATATGTTCTGAATTTTCCTTGG No data
1090008011_1090008016 29 Left 1090008011 11:123019509-123019531 CCTCTGTTTACCTCCTAAACCAC No data
Right 1090008016 11:123019561-123019583 TTTTCCTTGGTTCTTTTTAAAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090008011 Original CRISPR GTGGTTTAGGAGGTAAACAG AGG (reversed) Intergenic
No off target data available for this crispr