ID: 1090008015

View in Genome Browser
Species Human (GRCh38)
Location 11:123019548-123019570
Sequence CATATGTTCTGAATTTTCCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090008012_1090008015 6 Left 1090008012 11:123019519-123019541 CCTCCTAAACCACAGCTGTTTGT No data
Right 1090008015 11:123019548-123019570 CATATGTTCTGAATTTTCCTTGG No data
1090008014_1090008015 -3 Left 1090008014 11:123019528-123019550 CCACAGCTGTTTGTGTTTCACAT No data
Right 1090008015 11:123019548-123019570 CATATGTTCTGAATTTTCCTTGG No data
1090008013_1090008015 3 Left 1090008013 11:123019522-123019544 CCTAAACCACAGCTGTTTGTGTT No data
Right 1090008015 11:123019548-123019570 CATATGTTCTGAATTTTCCTTGG No data
1090008011_1090008015 16 Left 1090008011 11:123019509-123019531 CCTCTGTTTACCTCCTAAACCAC No data
Right 1090008015 11:123019548-123019570 CATATGTTCTGAATTTTCCTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090008015 Original CRISPR CATATGTTCTGAATTTTCCT TGG Intergenic
No off target data available for this crispr