ID: 1090012317

View in Genome Browser
Species Human (GRCh38)
Location 11:123056276-123056298
Sequence CAGGTGTATGTCACTGCACA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090012317_1090012320 2 Left 1090012317 11:123056276-123056298 CCATGTGCAGTGACATACACCTG No data
Right 1090012320 11:123056301-123056323 GAGCCAGCTACTTGGAACTAAGG No data
1090012317_1090012322 6 Left 1090012317 11:123056276-123056298 CCATGTGCAGTGACATACACCTG No data
Right 1090012322 11:123056305-123056327 CAGCTACTTGGAACTAAGGCTGG No data
1090012317_1090012323 7 Left 1090012317 11:123056276-123056298 CCATGTGCAGTGACATACACCTG No data
Right 1090012323 11:123056306-123056328 AGCTACTTGGAACTAAGGCTGGG No data
1090012317_1090012324 18 Left 1090012317 11:123056276-123056298 CCATGTGCAGTGACATACACCTG No data
Right 1090012324 11:123056317-123056339 ACTAAGGCTGGGTGACCACTTGG No data
1090012317_1090012325 25 Left 1090012317 11:123056276-123056298 CCATGTGCAGTGACATACACCTG No data
Right 1090012325 11:123056324-123056346 CTGGGTGACCACTTGGACCCAGG No data
1090012317_1090012318 -6 Left 1090012317 11:123056276-123056298 CCATGTGCAGTGACATACACCTG No data
Right 1090012318 11:123056293-123056315 CACCTGTAGAGCCAGCTACTTGG 0: 7
1: 354
2: 30541
3: 106579
4: 133431

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090012317 Original CRISPR CAGGTGTATGTCACTGCACA TGG (reversed) Intergenic
No off target data available for this crispr