ID: 1090012319

View in Genome Browser
Species Human (GRCh38)
Location 11:123056295-123056317
Sequence TTCCAAGTAGCTGGCTCTAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090012319_1090012325 6 Left 1090012319 11:123056295-123056317 CCTGTAGAGCCAGCTACTTGGAA No data
Right 1090012325 11:123056324-123056346 CTGGGTGACCACTTGGACCCAGG No data
1090012319_1090012324 -1 Left 1090012319 11:123056295-123056317 CCTGTAGAGCCAGCTACTTGGAA No data
Right 1090012324 11:123056317-123056339 ACTAAGGCTGGGTGACCACTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090012319 Original CRISPR TTCCAAGTAGCTGGCTCTAC AGG (reversed) Intergenic
No off target data available for this crispr