ID: 1090012512

View in Genome Browser
Species Human (GRCh38)
Location 11:123057828-123057850
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 232
Summary {0: 5, 1: 3, 2: 2, 3: 22, 4: 200}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090012512_1090012517 -10 Left 1090012512 11:123057828-123057850 CCTCCTGCACTCTGGTACAGCTT 0: 5
1: 3
2: 2
3: 22
4: 200
Right 1090012517 11:123057841-123057863 GGTACAGCTTGGTGATGATGGGG 0: 2
1: 4
2: 1
3: 10
4: 123

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090012512 Original CRISPR AAGCTGTACCAGAGTGCAGG AGG (reversed) Exonic
900295716 1:1948234-1948256 AACCTGGACCTGAGCGCAGGTGG + Intronic
900731526 1:4264858-4264880 ATGCTGGACCAGAGTGTTGGGGG + Intergenic
901495344 1:9618009-9618031 GAGCTGGACCACAGTGAAGGAGG + Intergenic
903527783 1:24005501-24005523 AATGTCTACCAGAGTGCAGAAGG - Intergenic
906766811 1:48441274-48441296 AAGCTGTGCCAGTGTCCAGCAGG - Intronic
907842477 1:58170923-58170945 AGGCTGCACCAGTGTCCAGGAGG - Intronic
908659649 1:66422878-66422900 AGGCTGCACCAGTGTCCAGGAGG + Intergenic
909823774 1:80099317-80099339 AAACTGTCCAAGAGTGAAGGGGG + Intergenic
910591107 1:88928743-88928765 AGGCTGTGCCAGTGTCCAGGAGG - Intergenic
911125684 1:94339209-94339231 CTTCTGTACCAGACTGCAGGTGG - Intergenic
911129645 1:94375532-94375554 AAGCTGTGCCAGTGTTCAGGAGG + Intergenic
911209870 1:95127691-95127713 AAGCTGAAGCAGAGACCAGGTGG - Intronic
913713623 1:121511825-121511847 AAGATGCACCAGTGTCCAGGAGG - Intergenic
914332176 1:146682592-146682614 AAGCTTTAACAGAGGCCAGGGGG - Intergenic
916170541 1:161998501-161998523 AAGGTGTACAGGAGCGCAGGTGG + Intronic
918750056 1:188260440-188260462 AAGCTGCACTAGTGTCCAGGAGG + Intergenic
920342404 1:205283969-205283991 AAGGTGTTCCAGAGCTCAGGGGG - Intergenic
921048146 1:211491709-211491731 CAGCTGTGCCAGGGTGCGGGTGG + Intronic
922423103 1:225472291-225472313 AGGCTGCAAGAGAGTGCAGGAGG - Intergenic
1063321574 10:5056952-5056974 AGGCTGCACCAGTGTCCAGGAGG + Intronic
1064000871 10:11662783-11662805 AATCTGTACCAGTGAGCATGAGG - Intergenic
1068061668 10:52075831-52075853 AAGAGATACCAGAGAGCAGGTGG - Intronic
1068142661 10:53027027-53027049 AGGCTGCACCAGTGTCCAGGAGG + Intergenic
1068404823 10:56574937-56574959 AAACTGTGCCAGTGTCCAGGAGG + Intergenic
1069212667 10:65780416-65780438 AAGCTCTCCCAGAATGCAGTGGG - Intergenic
1070049662 10:72875839-72875861 GAGCTGTGTCAGCGTGCAGGTGG + Intronic
1070281694 10:75053651-75053673 AAGCTGTTTCAGAGTTGAGGAGG - Intronic
1071467118 10:85951319-85951341 AAGCAGCACCAGTGTGCAGAGGG + Intronic
1071834993 10:89409645-89409667 AAGCTGCACCAGTGTCCAGGAGG - Intronic
1073295337 10:102435267-102435289 AAGCAGTACCAAAGGGCAGTGGG - Intergenic
1073599922 10:104836625-104836647 AAGCTCTACAAGAGTGAAGAGGG - Intronic
1073805554 10:107093840-107093862 GAGCTGGAGCAGAGTGAAGGAGG - Intronic
1075595929 10:123729039-123729061 AAGATGAACCAGAGTTCAGCTGG - Intronic
1076109245 10:127848655-127848677 AAGGGGTCCCTGAGTGCAGGAGG - Intergenic
1077181799 11:1220233-1220255 AGGCTGTTCCAGGGTGGAGGCGG + Intergenic
1077541042 11:3146653-3146675 CAGCTGTGCCTGAGTGCAGGGGG + Intronic
1078093366 11:8281533-8281555 ATGCTGTACCAGAATACAGAAGG - Intergenic
1078332441 11:10436412-10436434 AAGCAGTATCAGGGTCCAGGAGG + Intronic
1078705670 11:13741271-13741293 GAGCTGTACCCGAGTCCAGCAGG - Intergenic
1079731079 11:23938302-23938324 AGGCTGCACCAGTGTCCAGGAGG + Intergenic
1081128191 11:39344348-39344370 AAGCTGTGCCAGATTGAAGAAGG + Intergenic
1086112760 11:83217530-83217552 AGGCTGTGCCAGTGTCCAGGAGG + Intronic
1086964028 11:93009246-93009268 AGGCTGCAACAGAGTGGAGGTGG + Intergenic
1087319398 11:96639672-96639694 ATGCTGCACCAGTGTCCAGGAGG - Intergenic
1087458860 11:98421724-98421746 AAGGTGTGCCAGTGTCCAGGAGG + Intergenic
1090012512 11:123057828-123057850 AAGCTGTACCAGAGTGCAGGAGG - Exonic
1090870270 11:130738364-130738386 CAGCTGTATCAGAGATCAGGCGG - Intergenic
1091573772 12:1713899-1713921 AAGCTGTACCGGTGTCCAGGAGG + Intronic
1091895433 12:4099407-4099429 AAGCTGTACCAGAGTGCAGGAGG + Intergenic
1093022923 12:14219637-14219659 AGGCTGTGCCAGTGTCCAGGAGG - Intergenic
1093027224 12:14255953-14255975 AAGCTTGACCAGAGGGTAGGAGG + Intergenic
1093650652 12:21641467-21641489 AAACTGTTCCAGAATGAAGGAGG + Intronic
1095876802 12:47088330-47088352 TGGCTGTACCAGAGTCCAGCAGG + Intronic
1095990718 12:48032715-48032737 AGGCTGTACCAGAGCGGAGCAGG + Intergenic
1097181037 12:57172023-57172045 CAGCTGGAGTAGAGTGCAGGGGG - Intronic
1097428444 12:59474132-59474154 AAGCTGTGCCAGTGTCCAGGAGG - Intergenic
1097661566 12:62436141-62436163 CTGCTGTATCAGAGAGCAGGAGG + Intergenic
1100393208 12:94162354-94162376 GAGCAGAAGCAGAGTGCAGGAGG + Intronic
1102250714 12:111385564-111385586 AAGCTGGACCCAAGTGCAGGAGG + Intergenic
1103923642 12:124412113-124412135 AAGGTGGGCCAGAGTGAAGGCGG + Intronic
1104767250 12:131338120-131338142 AAGCTGCACCAGTGTCCAGGAGG - Intergenic
1106465889 13:30014170-30014192 AAGCTTTACCAGAGAACAGCTGG + Intergenic
1111372658 13:87336765-87336787 AGGCTGTGCCAGTGTCCAGGAGG - Intergenic
1112586451 13:100722933-100722955 AAGGTGTACCTGGGTGCAGAGGG + Intergenic
1113203783 13:107894039-107894061 AGGCTGCACCAGTGTCCAGGAGG + Intergenic
1114988798 14:28262832-28262854 GAGCTGTACCGTAGTGGAGGAGG - Intergenic
1116938472 14:50767007-50767029 AAGCTGTAGTAGACTACAGGAGG + Intronic
1119621053 14:76132070-76132092 TGGCTGTAGCAGAGTGCTGGGGG + Intergenic
1120699570 14:87684079-87684101 AAGCTGTCCCAGAGTGCCAAAGG + Intergenic
1121703501 14:95974188-95974210 AAGCTTTCCCATAGTGGAGGAGG - Intergenic
1124096326 15:26651756-26651778 ATGCTGTACCAGAGTGAGGTTGG - Intronic
1126086307 15:45013842-45013864 AGGCTGTGCCAGTGTCCAGGAGG - Intergenic
1128047716 15:64633662-64633684 AAGCTGTAACAGAGACCATGTGG + Intronic
1128867993 15:71130021-71130043 GAGCTGTTCCAGAGTGAATGGGG + Intronic
1133982635 16:10644878-10644900 AATCTGTCCCAGTGTGCTGGAGG + Intronic
1136011621 16:27367252-27367274 GGGCTGGACCAGAGGGCAGGAGG + Intergenic
1138207710 16:55136988-55137010 AAGCTTAACCAGAATGCAGTGGG - Intergenic
1138851466 16:60634481-60634503 ACGCTGTAGAAGAGTGCAGTGGG + Intergenic
1139792121 16:69446805-69446827 AAACTGTTCCAGATTGAAGGAGG - Intronic
1140001375 16:71028326-71028348 AAGCTTTAACAGAGGCCAGGGGG + Intronic
1141945004 16:87303764-87303786 AAGCTGCACCAACATGCAGGCGG + Intronic
1143038418 17:4014812-4014834 AAGGTGGACCTGAGTGCATGGGG + Intronic
1144654230 17:17025216-17025238 TAGCTGTCCCAGAGGGCAGCCGG + Intergenic
1150223151 17:63508405-63508427 GAGCTTTCCCAGAGTGAAGGTGG + Intronic
1152159212 17:78656911-78656933 AATCTGCACCAGAATGCAAGAGG - Intergenic
1152961077 18:80451-80473 AGTCTGGAACAGAGTGCAGGAGG + Intergenic
1155883984 18:31185361-31185383 AAGCGGTCCCAGAAAGCAGGAGG - Intergenic
1157293625 18:46426575-46426597 GAGCTGTACCATAAAGCAGGGGG - Intronic
1157301777 18:46484627-46484649 AAGATGTAGCAGAGTTAAGGGGG + Intronic
1158721417 18:59928537-59928559 AATCAGAACCAAAGTGCAGGTGG - Intergenic
1159728675 18:71996772-71996794 AAACAGTACCTGAGTACAGGGGG - Intergenic
1160600163 18:80006413-80006435 ATGCTGTAACAGAGTGCAGTGGG + Intronic
1162108044 19:8382735-8382757 AAGCCGCACCAGTGTCCAGGAGG - Intronic
1167511009 19:49895349-49895371 GAGCAGTTCCAGACTGCAGGAGG + Intronic
925112324 2:1346957-1346979 ATGCTGTACCAGAGTCAGGGTGG + Intronic
925364464 2:3302550-3302572 AAGCTGATCCTGAGTGCAGTTGG + Intronic
926590180 2:14732405-14732427 AAGCTGTAAAAGAGTGCACATGG + Intergenic
927678414 2:25123741-25123763 AAGCTGTCCCAGGGTGGTGGGGG + Intronic
929923241 2:46188558-46188580 AAGGAGTCCCAGAGTGAAGGAGG - Intergenic
930038665 2:47103860-47103882 AGGCTGTGCCAGTGTCCAGGAGG - Intronic
930499845 2:52200511-52200533 AAGCAGTAGCAGAGTCGAGGAGG + Intergenic
930690277 2:54355647-54355669 AAGCTGTCCCAGAAGGCAGCAGG - Intronic
931670017 2:64638895-64638917 AAGGTGAATCAGAGTGGAGGTGG + Intronic
933342280 2:81038521-81038543 AAGCTGTGCCAGTGTCCAGGAGG - Intergenic
933405461 2:81851993-81852015 AAGCTATATCAGAGGGCATGAGG + Intergenic
934867262 2:97824361-97824383 AGGCTGCACCAGTGTCCAGGTGG - Intronic
938635770 2:133224706-133224728 ACTCTGTACCAGAGAGGAGGAGG - Intronic
942294079 2:174500673-174500695 ATGCTATACCAGAGTCCAGTTGG + Intergenic
942511735 2:176709766-176709788 GAGCTGTGCCAGAGCGCAGTAGG + Intergenic
943133881 2:183888710-183888732 AGGCTGTGCCAGTGTCCAGGAGG - Intergenic
945557674 2:211299640-211299662 ACGCTCTAGCAGAGTGCAGCAGG + Intergenic
945560148 2:211329799-211329821 ACGCTGCAGCAGAGTGCAGCAGG - Intergenic
948666245 2:239536425-239536447 CACCTGCACCAGAGTCCAGGGGG - Intergenic
1170559635 20:17545840-17545862 AAGCTGTGCCAATGTGCAGGTGG - Intronic
1171261624 20:23739189-23739211 AAGCTGTGCCAGTGTCCAGGAGG - Intergenic
1171270763 20:23815079-23815101 AAGCTGTGCCAGTGTCCAGGAGG - Intergenic
1171389035 20:24789499-24789521 GAGCTGAAGCAGAGGGCAGGGGG - Intergenic
1175063602 20:56266393-56266415 CACCTGTACAAGACTGCAGGAGG - Intergenic
1178901549 21:36602973-36602995 AGAATGTACCAGAATGCAGGAGG - Intergenic
1182192539 22:28477782-28477804 CAGTTGTACGAGAGGGCAGGTGG - Intronic
1183360921 22:37383086-37383108 CAGCTGTACCCAAGGGCAGGAGG - Intronic
950549185 3:13655845-13655867 AGGCTTTCCCAGAGAGCAGGAGG + Intergenic
951207552 3:19940339-19940361 AAGCTCTAGCAGAGTGCAGGAGG - Intronic
951437542 3:22682034-22682056 AAGCTGTATCAGAGAAAAGGTGG + Intergenic
951651590 3:24956883-24956905 AAGCTGGACCAGAGAGAAGGAGG + Intergenic
954599049 3:51853428-51853450 AGGCTGCACCAGTGTCCAGGAGG - Intergenic
954961153 3:54566125-54566147 AGTCTCTACCAGAGTGCAGCTGG - Intronic
955035941 3:55267853-55267875 AAGATGTATCAGTGTGCATGTGG - Intergenic
955828935 3:62980832-62980854 AGGCTGGACCACAATGCAGGTGG - Intergenic
956263107 3:67366725-67366747 AAACTCTAACAGAGTGCTGGAGG - Intronic
956539795 3:70323804-70323826 AAGCTGAAGCAGACTCCAGGAGG - Intergenic
960063810 3:113349786-113349808 AAGCTGCACCAGTGTCCAGGAGG - Intronic
961166817 3:124769383-124769405 TAGATGGACCAGAGTGCAGATGG - Intronic
962073826 3:132059423-132059445 ATGCTGTAACAGAGTGCCGCAGG + Intronic
962187022 3:133270910-133270932 AAGCTGCACCAGAGTGAGTGAGG - Intronic
962689724 3:137882121-137882143 AAGCTGTACCAGAGTGCAGGAGG + Intergenic
963021374 3:140875606-140875628 AAGCTGTGCCAGTGTCCAGGAGG - Intergenic
964916838 3:161850400-161850422 AGGCTGTACCAGTGTCCAGGAGG + Intergenic
968138300 3:196235292-196235314 AGGCTGTACCTGAGTGATGGTGG - Exonic
968391097 4:193686-193708 AGGCTGCACCAGTGTCCAGGAGG + Intergenic
971578593 4:28306284-28306306 AGGCTGCACCAGTGTACAGGAGG - Intergenic
972019620 4:34295106-34295128 AAGCTGTAGCATGGTGAAGGAGG + Intergenic
972947898 4:44280523-44280545 AAGCTGCTCCAGAGTGAAGAAGG + Intronic
973577253 4:52302804-52302826 AAGCTGAGCCAGAGTACATGGGG + Intergenic
976374844 4:84333982-84334004 AAGCTAAAACAGTGTGCAGGGGG - Intergenic
976610889 4:87029255-87029277 AAGGTCTCCCTGAGTGCAGGTGG + Intronic
977622036 4:99148911-99148933 AAGCTGTGCCTATGTGCAGGTGG - Intronic
978747287 4:112208718-112208740 AAGCTGCACCAGTGTCCAGGAGG - Intergenic
980983751 4:139675672-139675694 AAGCTGCAGAAGAGTGCAGCGGG + Intronic
982877411 4:160665626-160665648 AAGCTGCACCAGTGTCCAGGAGG - Intergenic
984883531 4:184430310-184430332 AGGCTGGGCCAGACTGCAGGAGG - Intronic
985435584 4:189927072-189927094 AAGCTTTCCCATAGTGAAGGAGG - Intergenic
988030723 5:25759491-25759513 AAGCTGTGCCTACGTGCAGGTGG + Intergenic
989802948 5:45566760-45566782 AACCCGTCCCAGAGTGCAGAAGG - Intronic
989964258 5:50450317-50450339 AAGATGCACCAGTGTCCAGGAGG + Intergenic
990103348 5:52221156-52221178 AAGCTGCAGAAGAGTGCAGCCGG - Intergenic
991066761 5:62432269-62432291 AAGCTCTACCACAGGGCAGCAGG - Intronic
993473006 5:88329717-88329739 AAGATGTTACAGAGTTCAGGAGG + Intergenic
994556781 5:101316147-101316169 AAGCTTTCCCATAGTGAAGGAGG - Intergenic
994710921 5:103262734-103262756 AAGCTGAAACAGAATGCAGTGGG - Intronic
996099114 5:119429579-119429601 AGGCTGCACCAGTGTCCAGGAGG + Intergenic
997032056 5:130141838-130141860 AACCTGTACCAGAGTACAGGAGG + Intronic
997072507 5:130636862-130636884 AAGCTGTGCCAGTGTCCAGAAGG - Intergenic
997405231 5:133640436-133640458 ACGGTGTCCCAGAGAGCAGGAGG - Intergenic
997596624 5:135111474-135111496 CAGGTCTACCAGAGTGCTGGAGG - Intronic
998534444 5:142916398-142916420 AATCTGTAACTGAGTGCACGTGG - Intronic
1000184883 5:158849509-158849531 GTGCTGTAACAGAGTGTAGGTGG - Intronic
1001316446 5:170644397-170644419 GAGCTATATCAGAGTGGAGGAGG + Intronic
1002803434 6:549022-549044 AAGCTTTAGCAGGGTGAAGGCGG + Intronic
1007384627 6:41512328-41512350 AAGCTGACCCAGTGTCCAGGGGG - Intergenic
1009470913 6:64027902-64027924 AGGCTGTGCCAGTGTCCAGGAGG - Intronic
1011374943 6:86678110-86678132 AGGCTGCACCAGTGTCCAGGAGG + Intergenic
1011591802 6:88977103-88977125 AAGCTGCAGAAGAGTGCAGCAGG - Intergenic
1011806804 6:91081192-91081214 AAGAAGTACAAGAGGGCAGGTGG - Intergenic
1011848629 6:91598573-91598595 AAGCTGTCCCAAACTGCATGAGG + Intergenic
1014090863 6:117402217-117402239 TGGCTGAACAAGAGTGCAGGAGG - Intronic
1014684966 6:124485719-124485741 AAGCTCTACCAGTGTGCAGCAGG + Intronic
1017103047 6:150865567-150865589 AAGCTGTACCAGACAGAGGGTGG - Exonic
1019316741 7:390464-390486 AGGCTGCAGCCGAGTGCAGGAGG + Intergenic
1020615371 7:10453135-10453157 AAGCTGTACCAGAGTGCAGAAGG + Intergenic
1020721572 7:11751540-11751562 AGAGTGTACCAGAGTCCAGGTGG + Intronic
1022537288 7:31106163-31106185 AAGCAGTCCCACAGGGCAGGTGG - Intronic
1023227093 7:37982206-37982228 AACTTGTACCAGGGTGCAAGTGG + Intronic
1025159078 7:56637152-56637174 CAGCTGTAGCAGAGTGCTAGTGG - Intergenic
1027967398 7:85029580-85029602 AAACTGGACTAGAGTGCAGAAGG + Intronic
1028973959 7:96891519-96891541 AAGCTGTGGCAGAGTGTGGGGGG - Intergenic
1032404832 7:131648509-131648531 AAACTGAAGCAGAGGGCAGGTGG - Intergenic
1032838316 7:135693957-135693979 AAGCTGGCCCAGATTTCAGGTGG - Intronic
1033956409 7:146854197-146854219 AAGCTGGACCAGGGTCCATGTGG + Intronic
1035440263 7:158891298-158891320 AAGCTGGACCAGAGGCCGGGAGG + Exonic
1037582205 8:20252415-20252437 AAGCCGTGCCTGAGTTCAGGCGG - Intronic
1038744055 8:30240881-30240903 AAGCTGTACCAGAGTGCAGAAGG + Intergenic
1039276105 8:35935270-35935292 AAGCTACACCAGTGTCCAGGAGG - Intergenic
1039468754 8:37801063-37801085 AGGCTTTCTCAGAGTGCAGGAGG - Intronic
1040796717 8:51295997-51296019 AGGCTGCACCAGTGTCCAGGAGG + Intergenic
1040964957 8:53073814-53073836 AGGCTGTGCCAGTGTCCAGGAGG + Intergenic
1040971361 8:53140300-53140322 AAGCTGTGCCAGTGTCCAGAAGG + Intergenic
1041002010 8:53462864-53462886 AGGCTGTGCCAGTGTCCAGGAGG - Intergenic
1042772016 8:72391227-72391249 AGGCTGTGCCAGTGTCCAGGAGG - Intergenic
1042797507 8:72680561-72680583 AGGCTGTCCCATAGTCCAGGTGG + Intronic
1043257157 8:78150854-78150876 AAGCTGCACCAGTGTCCAGGAGG - Intergenic
1044891886 8:96844924-96844946 AAGCTGTACCAAAGTTGTGGTGG + Intronic
1047520329 8:125591074-125591096 AAGCTGGACCAGGGAGCTGGGGG + Intergenic
1049408330 8:142461497-142461519 AGGCTGTACCAGTTTCCAGGTGG + Intronic
1049565226 8:143334715-143334737 AAGGTGTCCCAGTGAGCAGGCGG - Intronic
1051356728 9:16246281-16246303 AAGCTGTAGCACAAAGCAGGGGG - Intronic
1053417116 9:37953728-37953750 ATGCTGTTCTAGAGTTCAGGAGG - Intronic
1055458184 9:76492479-76492501 AAGCCGCACCAGTGTCCAGGAGG + Intronic
1056392686 9:86153999-86154021 AGGCTGCACCAGTGTCCAGGAGG + Intergenic
1056850570 9:90080408-90080430 AAGCTGCACCATTGGGCAGGTGG - Intergenic
1057445643 9:95112585-95112607 AGGCTGTACCAGAGTGAGGAGGG + Intronic
1058614296 9:106809410-106809432 AAGCTGTAACAGACTGTAGCTGG + Intergenic
1060533239 9:124361404-124361426 CAGCTGTACCCGAGTGCTTGAGG + Intronic
1060879301 9:127106765-127106787 GGGCTGAACCTGAGTGCAGGAGG - Intronic
1062737083 9:138143535-138143557 AGTCTGGAACAGAGTGCAGGAGG - Intergenic
1186172404 X:6891342-6891364 AGGCTGCACCTTAGTGCAGGAGG - Intergenic
1187174293 X:16882368-16882390 AAGCTGTGCCAGACCTCAGGAGG + Intergenic
1188107628 X:26163314-26163336 AAGCTGTACCACAAGGCAGGAGG - Intergenic
1188111019 X:26196543-26196565 AAGCTGTACCACAAGGCAGGAGG - Intergenic
1188441850 X:30221358-30221380 AAGCTGTAGCACAAAGCAGGGGG - Intergenic
1189946612 X:46186951-46186973 AGGCTGTGCCAGTGTCCAGGAGG - Intergenic
1195439668 X:104886031-104886053 AGGCTGTGCCAGTGTCCAGGAGG - Intronic
1196354532 X:114774922-114774944 AAGCGGTACCAGAGTGCAGGAGG - Intronic
1196754296 X:119144283-119144305 AGGTTGTACCAGAGAGCAGCAGG - Intronic
1196980081 X:121203173-121203195 AAGCTGTACCAGAGTGCAGGAGG - Intergenic
1197249890 X:124204588-124204610 AAGCTGTACCAGAGTGCAGGAGG - Intronic
1197280570 X:124530896-124530918 AAGCTGTAACAAATTTCAGGAGG + Intronic
1200711368 Y:6487572-6487594 AGGCTGCACCAGTGTCCAGGAGG - Intergenic
1200800931 Y:7386613-7386635 AGGCTGTGCCAGTGTCCAGGAGG + Intergenic
1201022567 Y:9674414-9674436 AGGCTGCACCAGTGTCCAGGAGG + Intergenic
1201555827 Y:15263990-15264012 AGGCTGCACCAGTGTCCAGGAGG - Intergenic
1202089786 Y:21177747-21177769 AAGCTGCACCAGTGTCCATGAGG + Intergenic