ID: 1090033582

View in Genome Browser
Species Human (GRCh38)
Location 11:123228922-123228944
Sequence CAGGGTCAGGATGAGAAGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090033582_1090033588 13 Left 1090033582 11:123228922-123228944 CCTGCCTTCTCATCCTGACCCTG No data
Right 1090033588 11:123228958-123228980 ATGTGCCCCCTTCAAAATTCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090033582 Original CRISPR CAGGGTCAGGATGAGAAGGC AGG (reversed) Intergenic
No off target data available for this crispr