ID: 1090034592

View in Genome Browser
Species Human (GRCh38)
Location 11:123237746-123237768
Sequence TATCTTGTAGGAAAGATTGC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090034583_1090034592 30 Left 1090034583 11:123237693-123237715 CCACAAAAGGCATTGTACTTGCA No data
Right 1090034592 11:123237746-123237768 TATCTTGTAGGAAAGATTGCTGG No data
1090034589_1090034592 -10 Left 1090034589 11:123237733-123237755 CCACCAATGGAACTATCTTGTAG No data
Right 1090034592 11:123237746-123237768 TATCTTGTAGGAAAGATTGCTGG No data
1090034588_1090034592 2 Left 1090034588 11:123237721-123237743 CCTGAGCTTGGTCCACCAATGGA No data
Right 1090034592 11:123237746-123237768 TATCTTGTAGGAAAGATTGCTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090034592 Original CRISPR TATCTTGTAGGAAAGATTGC TGG Intergenic
No off target data available for this crispr