ID: 1090037893

View in Genome Browser
Species Human (GRCh38)
Location 11:123264597-123264619
Sequence CCACGTGTTTCCAGACTCAA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090037893_1090037902 19 Left 1090037893 11:123264597-123264619 CCCTTGAGTCTGGAAACACGTGG No data
Right 1090037902 11:123264639-123264661 ACCTCTCCACAGTGATTGTGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090037893 Original CRISPR CCACGTGTTTCCAGACTCAA GGG (reversed) Intergenic
No off target data available for this crispr