ID: 1090040059

View in Genome Browser
Species Human (GRCh38)
Location 11:123282973-123282995
Sequence TTGTAGATTTGCAGGCAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090040059_1090040063 -8 Left 1090040059 11:123282973-123282995 CCTTCCTGCCTGCAAATCTACAA No data
Right 1090040063 11:123282988-123283010 ATCTACAACTCCCCCTCCAAGGG No data
1090040059_1090040074 28 Left 1090040059 11:123282973-123282995 CCTTCCTGCCTGCAAATCTACAA No data
Right 1090040074 11:123283024-123283046 TGGGATGGAGGAAAGAACTTCGG No data
1090040059_1090040071 9 Left 1090040059 11:123282973-123282995 CCTTCCTGCCTGCAAATCTACAA No data
Right 1090040071 11:123283005-123283027 CAAGGGAAGAATGGTGCTGTGGG No data
1090040059_1090040073 16 Left 1090040059 11:123282973-123282995 CCTTCCTGCCTGCAAATCTACAA No data
Right 1090040073 11:123283012-123283034 AGAATGGTGCTGTGGGATGGAGG No data
1090040059_1090040062 -9 Left 1090040059 11:123282973-123282995 CCTTCCTGCCTGCAAATCTACAA No data
Right 1090040062 11:123282987-123283009 AATCTACAACTCCCCCTCCAAGG No data
1090040059_1090040070 8 Left 1090040059 11:123282973-123282995 CCTTCCTGCCTGCAAATCTACAA No data
Right 1090040070 11:123283004-123283026 CCAAGGGAAGAATGGTGCTGTGG No data
1090040059_1090040072 13 Left 1090040059 11:123282973-123282995 CCTTCCTGCCTGCAAATCTACAA No data
Right 1090040072 11:123283009-123283031 GGAAGAATGGTGCTGTGGGATGG No data
1090040059_1090040064 0 Left 1090040059 11:123282973-123282995 CCTTCCTGCCTGCAAATCTACAA No data
Right 1090040064 11:123282996-123283018 CTCCCCCTCCAAGGGAAGAATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090040059 Original CRISPR TTGTAGATTTGCAGGCAGGA AGG (reversed) Intergenic
No off target data available for this crispr