ID: 1090042423

View in Genome Browser
Species Human (GRCh38)
Location 11:123302375-123302397
Sequence GCGGCTGCCGGGCGACAACG CGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090042415_1090042423 21 Left 1090042415 11:123302331-123302353 CCTGAGCCAGGCGGAGAGCGCTG No data
Right 1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG No data
1090042419_1090042423 -3 Left 1090042419 11:123302355-123302377 CCGCTTTAGAGAACTGTTAGGCG No data
Right 1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG No data
1090042413_1090042423 23 Left 1090042413 11:123302329-123302351 CCCCTGAGCCAGGCGGAGAGCGC No data
Right 1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG No data
1090042416_1090042423 15 Left 1090042416 11:123302337-123302359 CCAGGCGGAGAGCGCTGCCCGCT No data
Right 1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG No data
1090042418_1090042423 -2 Left 1090042418 11:123302354-123302376 CCCGCTTTAGAGAACTGTTAGGC No data
Right 1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG No data
1090042412_1090042423 26 Left 1090042412 11:123302326-123302348 CCTCCCCTGAGCCAGGCGGAGAG No data
Right 1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG No data
1090042414_1090042423 22 Left 1090042414 11:123302330-123302352 CCCTGAGCCAGGCGGAGAGCGCT No data
Right 1090042423 11:123302375-123302397 GCGGCTGCCGGGCGACAACGCGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090042423 Original CRISPR GCGGCTGCCGGGCGACAACG CGG Intergenic
No off target data available for this crispr