ID: 1090043185

View in Genome Browser
Species Human (GRCh38)
Location 11:123308657-123308679
Sequence GTGCTGGCCCTGAAAATGAG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090043182_1090043185 -1 Left 1090043182 11:123308635-123308657 CCTCACCATACAAAAAAATATTG No data
Right 1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG No data
1090043183_1090043185 -6 Left 1090043183 11:123308640-123308662 CCATACAAAAAAATATTGTGCTG No data
Right 1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG No data
1090043180_1090043185 14 Left 1090043180 11:123308620-123308642 CCATATTTATTAAGCCCTCACCA No data
Right 1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG No data
1090043181_1090043185 0 Left 1090043181 11:123308634-123308656 CCCTCACCATACAAAAAAATATT No data
Right 1090043185 11:123308657-123308679 GTGCTGGCCCTGAAAATGAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090043185 Original CRISPR GTGCTGGCCCTGAAAATGAG AGG Intergenic
No off target data available for this crispr