ID: 1090046187

View in Genome Browser
Species Human (GRCh38)
Location 11:123335870-123335892
Sequence ACCATTCAGGATTACGTTGA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090046183_1090046187 -10 Left 1090046183 11:123335857-123335879 CCCCTTAGCTCTAACCATTCAGG No data
Right 1090046187 11:123335870-123335892 ACCATTCAGGATTACGTTGATGG No data
1090046182_1090046187 15 Left 1090046182 11:123335832-123335854 CCTTGCTATCATCTATATTAACT No data
Right 1090046187 11:123335870-123335892 ACCATTCAGGATTACGTTGATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090046187 Original CRISPR ACCATTCAGGATTACGTTGA TGG Intergenic
No off target data available for this crispr