ID: 1090047946

View in Genome Browser
Species Human (GRCh38)
Location 11:123352357-123352379
Sequence AGGTTAACACAGGTAGAAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090047946_1090047953 30 Left 1090047946 11:123352357-123352379 CCATTTTCTACCTGTGTTAACCT No data
Right 1090047953 11:123352410-123352432 AGCTTCCTTTTGTTCAAATTGGG No data
1090047946_1090047952 29 Left 1090047946 11:123352357-123352379 CCATTTTCTACCTGTGTTAACCT No data
Right 1090047952 11:123352409-123352431 CAGCTTCCTTTTGTTCAAATTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090047946 Original CRISPR AGGTTAACACAGGTAGAAAA TGG (reversed) Intergenic
No off target data available for this crispr