ID: 1090048439

View in Genome Browser
Species Human (GRCh38)
Location 11:123357097-123357119
Sequence CCTCCCAAATGCCCTTCCCT CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090048439_1090048443 12 Left 1090048439 11:123357097-123357119 CCGAGGGAAGGGCATTTGGGAGG No data
Right 1090048443 11:123357132-123357154 CCAGAGATAATAACATCTTCTGG No data
1090048439_1090048445 18 Left 1090048439 11:123357097-123357119 CCGAGGGAAGGGCATTTGGGAGG No data
Right 1090048445 11:123357138-123357160 ATAATAACATCTTCTGGGAAAGG No data
1090048439_1090048444 13 Left 1090048439 11:123357097-123357119 CCGAGGGAAGGGCATTTGGGAGG No data
Right 1090048444 11:123357133-123357155 CAGAGATAATAACATCTTCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090048439 Original CRISPR CCTCCCAAATGCCCTTCCCT CGG (reversed) Intergenic
No off target data available for this crispr