ID: 1090049149

View in Genome Browser
Species Human (GRCh38)
Location 11:123362141-123362163
Sequence GTTGCTGGTGATCCACAGTA GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090049146_1090049149 2 Left 1090049146 11:123362116-123362138 CCAACAGCAATGTTGTCTTCAGA No data
Right 1090049149 11:123362141-123362163 GTTGCTGGTGATCCACAGTAGGG No data
1090049144_1090049149 22 Left 1090049144 11:123362096-123362118 CCTCTTAGGTGTTCCTTAAACCA No data
Right 1090049149 11:123362141-123362163 GTTGCTGGTGATCCACAGTAGGG No data
1090049143_1090049149 30 Left 1090049143 11:123362088-123362110 CCATCTTTCCTCTTAGGTGTTCC No data
Right 1090049149 11:123362141-123362163 GTTGCTGGTGATCCACAGTAGGG No data
1090049145_1090049149 9 Left 1090049145 11:123362109-123362131 CCTTAAACCAACAGCAATGTTGT No data
Right 1090049149 11:123362141-123362163 GTTGCTGGTGATCCACAGTAGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090049149 Original CRISPR GTTGCTGGTGATCCACAGTA GGG Intergenic
No off target data available for this crispr