ID: 1090051126

View in Genome Browser
Species Human (GRCh38)
Location 11:123380832-123380854
Sequence CTCCAGTCCCAGAATGAGGA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090051126_1090051130 3 Left 1090051126 11:123380832-123380854 CCCTCCTCATTCTGGGACTGGAG No data
Right 1090051130 11:123380858-123380880 GTTTGGTTTTTTTATGTATCAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090051126 Original CRISPR CTCCAGTCCCAGAATGAGGA GGG (reversed) Intergenic
No off target data available for this crispr