ID: 1090056177

View in Genome Browser
Species Human (GRCh38)
Location 11:123426986-123427008
Sequence GTCAGAGGCCTGGCTGCAGG TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total
Summary

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090056172_1090056177 -7 Left 1090056172 11:123426970-123426992 CCTCCTTTCATTTAAAGTCAGAG No data
Right 1090056177 11:123426986-123427008 GTCAGAGGCCTGGCTGCAGGTGG No data
1090056174_1090056177 -10 Left 1090056174 11:123426973-123426995 CCTTTCATTTAAAGTCAGAGGCC No data
Right 1090056177 11:123426986-123427008 GTCAGAGGCCTGGCTGCAGGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090056177 Original CRISPR GTCAGAGGCCTGGCTGCAGG TGG Intergenic