ID: 1090066360

View in Genome Browser
Species Human (GRCh38)
Location 11:123507137-123507159
Sequence ACAAACACATGGAGAGCAGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090066360_1090066367 16 Left 1090066360 11:123507137-123507159 CCTTCTGCTCTCCATGTGTTTGT No data
Right 1090066367 11:123507176-123507198 CCAGGAATAAAGAGGATGGCAGG No data
1090066360_1090066362 -2 Left 1090066360 11:123507137-123507159 CCTTCTGCTCTCCATGTGTTTGT No data
Right 1090066362 11:123507158-123507180 GTACATTTGACTATCAGCCCAGG No data
1090066360_1090066364 12 Left 1090066360 11:123507137-123507159 CCTTCTGCTCTCCATGTGTTTGT No data
Right 1090066364 11:123507172-123507194 CAGCCCAGGAATAAAGAGGATGG No data
1090066360_1090066363 8 Left 1090066360 11:123507137-123507159 CCTTCTGCTCTCCATGTGTTTGT No data
Right 1090066363 11:123507168-123507190 CTATCAGCCCAGGAATAAAGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090066360 Original CRISPR ACAAACACATGGAGAGCAGA AGG (reversed) Intergenic
No off target data available for this crispr