ID: 1090071323

View in Genome Browser
Species Human (GRCh38)
Location 11:123546942-123546964
Sequence CACTGAGGCCCTGCTCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 228
Summary {0: 1, 1: 0, 2: 1, 3: 29, 4: 197}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090071323_1090071327 17 Left 1090071323 11:123546942-123546964 CCAGTAGGAGCAGGGCCTCAGTG 0: 1
1: 0
2: 1
3: 29
4: 197
Right 1090071327 11:123546982-123547004 TGTCAACCTGTCTTGAGAGAAGG 0: 1
1: 0
2: 1
3: 18
4: 173
1090071323_1090071329 23 Left 1090071323 11:123546942-123546964 CCAGTAGGAGCAGGGCCTCAGTG 0: 1
1: 0
2: 1
3: 29
4: 197
Right 1090071329 11:123546988-123547010 CCTGTCTTGAGAGAAGGATTTGG 0: 1
1: 0
2: 1
3: 12
4: 225

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090071323 Original CRISPR CACTGAGGCCCTGCTCCTAC TGG (reversed) Intronic
900284576 1:1892940-1892962 CACCGAGGCCCCGCCCCCACAGG + Intergenic
901689193 1:10961386-10961408 CGCTCAGCCCCTGCTCCTTCAGG + Intronic
903959278 1:27046626-27046648 GAGTGAGGCCTTGCTCCTTCTGG - Intergenic
905695423 1:39970027-39970049 CACTGAGCCCCAGGTGCTACTGG + Intergenic
907303982 1:53503707-53503729 CACTGAGCCCCCGCTCCTCCTGG - Intergenic
907976417 1:59435456-59435478 CACAGAGGCCCTGTGCCTTCTGG + Intronic
912474801 1:109928605-109928627 CACTGAGGCCCTGATTCCCCAGG + Intronic
914913776 1:151805888-151805910 CACTGAGGGACTGCTCCACCTGG + Exonic
918233913 1:182560504-182560526 CCCTGAGGTCCTGCACATACGGG - Exonic
920930009 1:210379038-210379060 CACTTAGTGCCTGCTCCTACAGG - Intronic
1069781738 10:70961312-70961334 GAGTGAGGGCCTGCTCCTGCCGG + Intergenic
1070647564 10:78212339-78212361 CACTGTGGCCCTGAGCCTACTGG - Intergenic
1070662385 10:78316598-78316620 CAGTGAGGCCCTGCTTGTCCTGG + Intergenic
1071056788 10:81520615-81520637 CTCTGAGGCCCAGCTGCTCCAGG + Intergenic
1072389478 10:94968761-94968783 CAGTGAGGCCCTTCTGCTGCAGG + Intronic
1072876284 10:99176013-99176035 CAGTGAGGCCCTTCTGCTGCAGG - Intronic
1075542481 10:123326767-123326789 CACTGAACCATTGCTCCTACAGG - Intergenic
1075815298 10:125260415-125260437 CACTGAGGACCTACCACTACTGG - Intergenic
1076567097 10:131406373-131406395 TACTGAGGCCTTGCTCCTAGGGG - Intergenic
1076994342 11:290852-290874 CACTGAGGCCCTGCAGCTGCAGG + Exonic
1077613595 11:3659993-3660015 GACTGAGGCCCTGCAGCTCCTGG + Exonic
1081399477 11:42626178-42626200 TACAGAGGCCCTGGTCCTTCTGG - Intergenic
1081825411 11:46046276-46046298 CACTGGGGCCATCCTCCTATGGG + Intronic
1082110020 11:48264181-48264203 CACTGAGGCCTTTCTCCTGATGG + Exonic
1082809110 11:57467898-57467920 CACCGAGGTCCAGCTCCTCCAGG - Exonic
1083163084 11:60867594-60867616 CCCTGTGGCCCTGCTACTGCTGG + Exonic
1083678470 11:64340717-64340739 CGATGGGGCCCTGCTCCTCCGGG + Exonic
1084028044 11:66465279-66465301 CACTGAGGACCTGCTCTGGCAGG + Intronic
1085433971 11:76482142-76482164 CACTCAGGCCCTTCTGCTGCAGG - Intronic
1085599607 11:77843419-77843441 CACTAAAGTCCTGCTCCTCCTGG + Intronic
1086414404 11:86574477-86574499 CACTGAGGCCCCTCTTCTGCAGG + Intronic
1087060382 11:93971373-93971395 CACTCAGTCCCTGTTCCTATGGG - Intergenic
1087461680 11:98455139-98455161 CCCTGAAGCCCTGCTCCTCCAGG - Intergenic
1089311680 11:117562152-117562174 CACTGAGGGCCAGCTGCTAGGGG + Intronic
1089499466 11:118923906-118923928 CTCTGAGGCCCTGCTGATAGAGG - Intronic
1089580234 11:119477023-119477045 CACTGAGCTCCTGCTCCTGCTGG - Intergenic
1090071323 11:123546942-123546964 CACTGAGGCCCTGCTCCTACTGG - Intronic
1090903287 11:131051376-131051398 CACTGGAGCCTTGCTCCTAGGGG - Intergenic
1091166602 11:133481855-133481877 CACTGAGGCCCTTCTATTCCAGG + Intronic
1091669225 12:2440541-2440563 CACTGAAGGCCTCCTCCTCCTGG - Intronic
1092569764 12:9709281-9709303 CCCTCAAGCCCTGCTCCTCCAGG + Intergenic
1095356530 12:41281108-41281130 CAGTCAGGCCCTTCTCCTGCAGG - Intronic
1096346387 12:50850713-50850735 CACTGCTGCCCTGCTACTGCTGG + Intronic
1098404442 12:70109004-70109026 CACTGAGGCCCTGCCACTGAAGG + Intergenic
1099373397 12:81866050-81866072 CACTGTGCCCATGCTCCTATGGG + Intergenic
1100651327 12:96592016-96592038 TACTGAAGCCCAGCTCCTAGTGG + Intronic
1100786826 12:98087531-98087553 CAGTGAGGTCCTGCACCCACTGG + Intergenic
1101522120 12:105493725-105493747 CACTGAGGCCTTCCTTCTCCAGG + Intergenic
1102476974 12:113195160-113195182 ACCTGAGGCCCCGCTCCTCCTGG + Intergenic
1102590353 12:113951896-113951918 CACTGAGGCCCTGTAGCTGCGGG - Intronic
1102717928 12:114990238-114990260 CCTTCAGGCCCTGCTCCTGCAGG - Intergenic
1104835123 12:131785108-131785130 CACTGACGCGCTGCTCTGACAGG - Exonic
1105949560 13:25217495-25217517 CAATGAGGCCCCGCTCCTCAAGG + Intergenic
1107114333 13:36730608-36730630 GAGTGAGGCCCTGATCCTATAGG + Intergenic
1111919503 13:94395873-94395895 CACTGTGGCCCTGGCCCTCCAGG + Intronic
1118589586 14:67391457-67391479 CACCAAGGCCCTGCTTCTGCTGG - Intronic
1119991821 14:79206948-79206970 CATTGAGCCCCTTTTCCTACCGG + Intronic
1120745014 14:88144907-88144929 CCCTCAAGCCCTGCTCCTCCGGG + Intergenic
1122968671 14:105143705-105143727 CACTGAGGCCCTGGCCACACTGG + Intronic
1123456097 15:20427555-20427577 CACTATGCACCTGCTCCTACAGG + Intergenic
1123635472 15:22303282-22303304 CACTATGCACCTGCTCCTACAGG - Intergenic
1125612331 15:40980006-40980028 CCCTGTGGCCTTCCTCCTACAGG + Exonic
1128114974 15:65099585-65099607 CAATGAGGTCTTGCTCCTCCTGG + Exonic
1128190468 15:65689596-65689618 AACTGAGGCCCTCCTCCCTCTGG + Intronic
1129152154 15:73696036-73696058 CCCTGTGGCCCTGCTTCTGCAGG + Intronic
1129165352 15:73774136-73774158 CACTGAGGGCCTGCTCTTCCAGG + Intergenic
1130870202 15:87965522-87965544 CACTGGGGCAATGCTCTTACAGG - Intronic
1130892491 15:88145013-88145035 CACTGAGCCCTTTCTCCTCCAGG + Intronic
1132516102 16:366731-366753 CTCTGAGGGCCTGCCCCTCCTGG + Intergenic
1132686241 16:1163302-1163324 CTCCCAGGCCCTGCTCCAACTGG - Intronic
1133232756 16:4374224-4374246 GGCTGAGGCCCTGCCCCTCCTGG - Intronic
1137538799 16:49347854-49347876 CTCAGTGGCCCTGCTCCCACAGG + Intergenic
1140209873 16:72961423-72961445 CCGTCTGGCCCTGCTCCTACAGG + Intronic
1143122390 17:4616839-4616861 CAGCGGGGCTCTGCTCCTACCGG + Intergenic
1143255319 17:5553465-5553487 CACTTAGGTCCAGCTCCTTCAGG + Exonic
1143491003 17:7285168-7285190 GACTGTGGCTCTGCTCCTGCTGG + Exonic
1144835390 17:18154109-18154131 CACTGAAGCCCCGCCCCTGCAGG + Exonic
1147566374 17:41538835-41538857 TGCTGAGGCCCTGCTCATCCCGG + Intergenic
1148793367 17:50185852-50185874 CAAGAAGGCCCTGCTCCTCCAGG - Exonic
1149015262 17:51901543-51901565 CACTGACACCCTACTCCCACTGG - Intronic
1150464611 17:65381467-65381489 CACTCAAGCCCTGGTACTACAGG - Intergenic
1150802992 17:68296442-68296464 CACGGAGGCACTGCTCCTAAAGG - Intronic
1151541903 17:74768881-74768903 CACTGAGTGCCTCATCCTACCGG + Exonic
1152189287 17:78878758-78878780 CCCTCAGGCTCTGCTCCTCCAGG - Intronic
1153231110 18:2937189-2937211 AAGTCAGGCCCTGCTCCAACTGG + Intronic
1153348949 18:4057932-4057954 CATAGAGGCTCTGCTCCTCCTGG + Intronic
1153507019 18:5811096-5811118 CACTGAAGTCCTGCTCCTCCTGG + Intergenic
1155074190 18:22340763-22340785 CACTGAGCACCTGCTTCTAGTGG - Intergenic
1160015672 18:75138507-75138529 CCATGAGGCCCTGCTCCTGGTGG + Intergenic
1160020671 18:75178318-75178340 TACTGAGGCATTGTTCCTACAGG - Intergenic
1160031161 18:75261116-75261138 CACTCAGGTCCTGCTCCTCCGGG - Intronic
1160761916 19:789739-789761 TACTGGGTCCCTGCTCCTGCTGG - Intergenic
1162016984 19:7851362-7851384 CACTGAGGCCCAGCACCCCCCGG + Intronic
1163130567 19:15270209-15270231 CACTGAGGCCCTGCTCGGGATGG + Intronic
1165402202 19:35608885-35608907 CACAGGGGCTCTGCTCCTTCAGG + Intergenic
1165892312 19:39121139-39121161 CAATCAGGCCCTGCTACTCCAGG - Intergenic
1166361467 19:42254492-42254514 CACTCACGCCCTCCTCCTAGAGG + Intronic
1166526431 19:43513256-43513278 CACTGGGGCACTGCCCCTAGTGG + Intronic
1167049740 19:47071081-47071103 CACTGAGGCACTGAGCCTTCTGG + Intronic
1167357641 19:49014033-49014055 TCCTGAGCCACTGCTCCTACTGG - Intronic
1168386418 19:55966876-55966898 ATCTGAGCCCCAGCTCCTACTGG + Intronic
925871801 2:8278194-8278216 CCCTGAGGCCTGGCTCCTGCTGG + Intergenic
926479773 2:13377611-13377633 CACTATGCACCTGCTCCTACAGG - Intergenic
929968639 2:46554277-46554299 CACTGCGGCCCTTCTCCACCAGG - Intronic
931988868 2:67769125-67769147 CTCTGTGCCCCTGCTCCTTCTGG - Intergenic
933881399 2:86673562-86673584 CACTGCTGCCCTGCTTCTTCAGG + Intronic
934938491 2:98482370-98482392 CCTTGAGGCCCTGCTCTGACTGG - Intronic
937135647 2:119549882-119549904 CACTGAGGCCCAACTCTTGCTGG + Intronic
945022296 2:205585691-205585713 CACTTAGGCCCTGCCTCTTCAGG + Intronic
947483152 2:230521796-230521818 CTCTCTGGCCCTGCTGCTACGGG + Intronic
948294151 2:236848238-236848260 CACTGAGTCCCTGCTTCTCCAGG + Intergenic
948477043 2:238227022-238227044 GACAGAGGCCCTGCTCCACCAGG + Intronic
1168758106 20:329772-329794 CACTCAGCCCTGGCTCCTACTGG - Exonic
1170678178 20:18501685-18501707 CACTGAGGCCCTCCTTCTAAAGG + Intergenic
1170678189 20:18501722-18501744 CACTGAGGCCCTCCTTCTAAAGG + Intergenic
1170678200 20:18501759-18501781 CACTGAGGCCCTCCTTCTAAAGG + Intergenic
1170678210 20:18501796-18501818 CACTGAGGCCCTCCTTCTAAAGG + Intergenic
1170678220 20:18501833-18501855 CACTGAGGCCCTCCTTCTAAAGG + Intergenic
1171035135 20:21707885-21707907 CACAGAGGCGCTGCTGCTGCTGG - Intronic
1172664690 20:36591034-36591056 CACTGAGGGGCTGCTGCCACGGG - Exonic
1173150588 20:40563535-40563557 CACTCCGGCACTGCTCCTGCAGG - Intergenic
1173242689 20:41311892-41311914 TTCTGAGGCCCTACACCTACTGG + Intronic
1173485982 20:43441409-43441431 CACGGGTGCCCTTCTCCTACAGG + Intergenic
1173863119 20:46297193-46297215 CACTCAGCCCCTGCCCCTCCTGG - Intronic
1174932014 20:54826506-54826528 CACTCAGGCCCTCCTCTAACTGG - Intergenic
1179391291 21:40994460-40994482 GACTGATGACCTTCTCCTACAGG - Intergenic
1179534924 21:42045265-42045287 GACTGAGGATCTGCTTCTACAGG - Intergenic
1179934766 21:44595337-44595359 TACTGAACCACTGCTCCTACAGG + Intronic
1179982902 21:44905744-44905766 CACCTGGGCCCTGCTCCTGCAGG + Intronic
1180179706 21:46112448-46112470 CCCGCAGGCCCTGCTCCTTCAGG - Exonic
1180980841 22:19877302-19877324 CTCTGAGGCCCTCCTCTTCCCGG - Intronic
1181590800 22:23883852-23883874 CACTGTGGCCCTGTGCCTGCAGG + Exonic
1181634241 22:24167025-24167047 CACTGATGCTCAGCTCCTCCAGG - Exonic
1181964549 22:26647479-26647501 GACTGGGGCCCCGCTCCTTCTGG - Intergenic
1182712843 22:32333326-32333348 CACTGAGGTCATGCTCCTTCCGG - Intergenic
1182873278 22:33667383-33667405 CACTGAGCTCCTCCTCCTACAGG + Intronic
1182878448 22:33712433-33712455 CACTGAGGCCATGAACCCACTGG + Intronic
1183343016 22:37292491-37292513 CACAGAGGCCCACCTCCTCCAGG - Intronic
1184226590 22:43132366-43132388 GACTGAGGCCCTGGTCCTAGGGG - Exonic
1185060337 22:48603242-48603264 CACTCAAGCCCTCCCCCTACCGG - Intronic
949133515 3:535269-535291 CAGTGAGGCCATGAACCTACCGG - Intergenic
950097647 3:10339190-10339212 CACTGGGGCCCACCCCCTACAGG - Intronic
950113283 3:10434332-10434354 CCCTGAGGCCCTCCTGCAACAGG + Intronic
950544970 3:13632955-13632977 CACCAAGGCCCTGTTCCTCCTGG + Intronic
950863630 3:16171907-16171929 CACTGAAGCCCTGCCTCTGCTGG - Intergenic
952912895 3:38205594-38205616 CACTGATGACCTTCTCCTGCTGG + Intronic
952919439 3:38274897-38274919 CACTGAGGCCCAGCCCCCACAGG + Intronic
953336248 3:42096683-42096705 CAATTAGGCCCTGCCCCTGCAGG + Intronic
953896606 3:46808076-46808098 CACTGAGCCCCAGCTCCCTCAGG + Intronic
953956436 3:47235469-47235491 CACTGAGGCCCCCATCCTCCTGG + Intronic
954358304 3:50101827-50101849 CAGTGAGTCCCTAATCCTACTGG - Intronic
954675085 3:52311235-52311257 CCTTGAGGCCCTGCGCCTCCAGG + Intergenic
955693937 3:61616842-61616864 GACTGAGGCACTGCTGCTGCAGG + Intronic
956343014 3:68247544-68247566 CACTGAGGCCCGGGTGCTGCAGG + Intronic
960326005 3:116296740-116296762 TACTGAGGCTCTACTCCTATGGG + Intronic
961353653 3:126320236-126320258 AATTGAGGCCCTGTTCCTGCAGG - Intergenic
961380715 3:126494915-126494937 CCCTGTGGCCCTGCTTGTACAGG - Intronic
962252004 3:133841260-133841282 GAGTGAGGCTCTGCTCCTAAGGG - Intronic
966486472 3:180476528-180476550 AACTCAGCCCCTGCTCCTAGAGG - Intergenic
966911260 3:184561700-184561722 CGCTGAGGCCCCGCCCCTAGCGG - Intronic
967131599 3:186476048-186476070 CACTGTTGCTCTGCTACTACTGG + Intergenic
968811913 4:2803953-2803975 CACTCAGGCACAGCACCTACAGG - Intronic
971236355 4:24845646-24845668 CAATGAGTCCCTGCTCCCATGGG - Intronic
975620841 4:76295000-76295022 CACTGAGGCCATGCTTCTCATGG - Intronic
978942604 4:114454978-114455000 CACTGAGCCTCTACTCCTAAGGG + Intergenic
979188944 4:117833723-117833745 CCCTCAAGCCCTGCTCCTCCGGG - Intergenic
980762926 4:137260553-137260575 CACTCAAGCCCGTCTCCTACAGG + Intergenic
981273280 4:142868607-142868629 CACTGAGGCCCCTCTGCTGCAGG - Intergenic
985494077 5:194804-194826 CACTGAGGTCCAGCACCTCCAGG - Exonic
986308560 5:6533535-6533557 CACTGAGCCCTGGCTCCCACGGG - Intergenic
986490932 5:8289365-8289387 CACTGAGGCCATGCTCCCATGGG - Intergenic
986604994 5:9514018-9514040 CAGCGAGGCCCTGCTCCCTCTGG + Intronic
987814706 5:22885024-22885046 GACTGAGGCCCTGATCCAATAGG + Intergenic
990468233 5:56089162-56089184 CACTGAGTCACTGCTGTTACTGG - Intergenic
991501858 5:67284801-67284823 CACTAAGGCCAAGCTCCTTCAGG - Intergenic
994389841 5:99179111-99179133 CACATAGGTCCTCCTCCTACTGG - Intergenic
996024853 5:118633291-118633313 CACTGAACCACTGCTCCTAGAGG + Intergenic
997917408 5:137941780-137941802 CTCTGAGGCCCTGCTTTTAATGG - Intronic
1000962534 5:167617058-167617080 CACAGAAGCTCTGCTCCAACTGG - Intronic
1001578038 5:172777559-172777581 CACGGAGGCCCTGCTGTTCCCGG - Intergenic
1002089771 5:176797698-176797720 CACTCAGGCCCTGTCCCTCCAGG + Intergenic
1002107426 5:176887064-176887086 CGCTCAGGCCCTGCTTCTGCTGG + Exonic
1002422936 5:179159016-179159038 CTCTCAGGACCTGCTCCCACTGG + Intronic
1003301943 6:4892131-4892153 CACTGCGGTCCTGCTCTTAACGG - Exonic
1006111689 6:31750569-31750591 GACTCACGCCCTGCTCGTACTGG - Intronic
1006409865 6:33866767-33866789 CTCTGAGGCTCTTCACCTACAGG - Intergenic
1006877743 6:37313364-37313386 CACTGAGGACCTGGTACTATAGG - Intronic
1009467331 6:63987976-63987998 GACTGAGTCTCTGCTCCTAAGGG + Intronic
1011919740 6:92557952-92557974 CACCAAGGCCCTGCTCTTAAAGG + Intergenic
1014215108 6:118745623-118745645 CACAGGGCCCCTGCTCTTACTGG - Intergenic
1016900523 6:149096709-149096731 CCTTAAGGCCCTGCTCCTTCTGG + Intergenic
1018000326 6:159572918-159572940 CACTGAGGCCCTTCTGCTTGAGG - Intergenic
1018903563 6:168062993-168063015 CAGTGAGGCCCAGCACCTCCAGG - Intronic
1019285843 7:222531-222553 CACGGAGGCCCTGCCCCTCCTGG + Intronic
1019624463 7:2008994-2009016 CGCTGGGGGCCTGCTCGTACTGG - Intronic
1019735158 7:2646846-2646868 CCCTCAGGCCCTGCTGCTCCTGG + Exonic
1020083333 7:5297855-5297877 CACAGAGGCACTGCCCCTACGGG + Intronic
1020179879 7:5913928-5913950 GAATGAGGCCCTGCTCATTCTGG + Intronic
1020303056 7:6810956-6810978 GAATGAGGCCCTGCTCATTCTGG - Intronic
1023994066 7:45148132-45148154 CTCTGAGACCCTCCTCCTCCGGG - Intergenic
1024109366 7:46129865-46129887 CACTGAGACCCTGGGCCTCCTGG - Intergenic
1025210944 7:57019344-57019366 CACAGAGGCACTGCCCCTACGGG - Intergenic
1025661011 7:63557503-63557525 CACAGAGGCACTGCCCCTACGGG + Intergenic
1027938364 7:84637601-84637623 CACTGTGGCTCTGCTCCTGGGGG + Intergenic
1033870802 7:145751595-145751617 CCCTCAAGCCCTGCTCCTCCAGG - Intergenic
1035382233 7:158447491-158447513 CCCTGGGGCCCTGCTGCTTCTGG - Intronic
1038309918 8:26438616-26438638 CACTGAGCACCTGCTGCTTCTGG - Intronic
1039432259 8:37534123-37534145 CACTGAGGGGCTCCTCCTGCTGG + Intergenic
1042870400 8:73392779-73392801 CTTTGAGGCCCTCCTACTACAGG + Intergenic
1049675634 8:143887677-143887699 CACTGAGGCACTTCTCCTCTCGG + Intergenic
1050439871 9:5650489-5650511 CACTGTGGCCCTGCTACTAGAGG + Intronic
1052283228 9:26756184-26756206 CAAGGAGGCCCTGCACCCACTGG + Intergenic
1056943892 9:90977543-90977565 CCCTCAGGCCCTGGTGCTACTGG - Intergenic
1059447573 9:114348409-114348431 CCCTGAGGCCCTGCACCTTGTGG + Intronic
1060231658 9:121829982-121830004 TAATGAGACTCTGCTCCTACAGG + Intronic
1060929500 9:127479847-127479869 CACTCAGGCCCTGCTCCAGCCGG - Exonic
1061434323 9:130551448-130551470 CGCTGGGGCCCTGCTCCACCCGG - Intergenic
1062233920 9:135499063-135499085 CACTGAGGCTATGCTTCTACTGG + Intronic
1062518002 9:136945681-136945703 CCCGGTGGCCCTGCTCCTGCAGG - Exonic
1062665773 9:137670691-137670713 CACTGAGGCCCTGCCCCTCCTGG + Intronic
1187607756 X:20905288-20905310 TACTGTAGCCCTGCTCCCACTGG - Intergenic
1187856075 X:23637157-23637179 CACTGTGGCCCTGCTGCTTGTGG - Intergenic
1188729625 X:33630853-33630875 CACTGTGGCCCTGCAGCTAGTGG - Intergenic
1190382736 X:49855371-49855393 CACTGAGGCCATGCTTCCCCAGG - Intergenic
1190651947 X:52576388-52576410 CACTGATTCCCTGCTGCTTCCGG + Intergenic
1196685096 X:118503963-118503985 CACTGACCCCCTGCTCCTCAGGG - Intronic
1196730775 X:118939086-118939108 CGCTGAGCCCCTCCTCCTCCAGG + Intergenic
1200785489 Y:7257033-7257055 TACTGAGGACCTGGTACTACAGG - Intergenic