ID: 1090074463

View in Genome Browser
Species Human (GRCh38)
Location 11:123571327-123571349
Sequence CACGCCCACTGCAGACACGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 1, 3: 6, 4: 128}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090074463_1090074476 -2 Left 1090074463 11:123571327-123571349 CCACCGTGTCTGCAGTGGGCGTG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1090074476 11:123571348-123571370 TGGGGGGTGAGGGTGGGGGCAGG 0: 1
1: 3
2: 85
3: 684
4: 4467
1090074463_1090074474 -7 Left 1090074463 11:123571327-123571349 CCACCGTGTCTGCAGTGGGCGTG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1090074474 11:123571343-123571365 GGGCGTGGGGGGTGAGGGTGGGG 0: 1
1: 2
2: 49
3: 374
4: 2929
1090074463_1090074475 -6 Left 1090074463 11:123571327-123571349 CCACCGTGTCTGCAGTGGGCGTG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1090074475 11:123571344-123571366 GGCGTGGGGGGTGAGGGTGGGGG 0: 1
1: 2
2: 39
3: 356
4: 2953
1090074463_1090074477 -1 Left 1090074463 11:123571327-123571349 CCACCGTGTCTGCAGTGGGCGTG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1090074477 11:123571349-123571371 GGGGGGTGAGGGTGGGGGCAGGG 0: 1
1: 4
2: 57
3: 630
4: 4407
1090074463_1090074473 -8 Left 1090074463 11:123571327-123571349 CCACCGTGTCTGCAGTGGGCGTG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1090074473 11:123571342-123571364 TGGGCGTGGGGGGTGAGGGTGGG 0: 1
1: 5
2: 31
3: 278
4: 2114
1090074463_1090074472 -9 Left 1090074463 11:123571327-123571349 CCACCGTGTCTGCAGTGGGCGTG 0: 1
1: 0
2: 1
3: 6
4: 128
Right 1090074472 11:123571341-123571363 GTGGGCGTGGGGGGTGAGGGTGG 0: 1
1: 4
2: 38
3: 319
4: 2668

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090074463 Original CRISPR CACGCCCACTGCAGACACGG TGG (reversed) Intronic
900271798 1:1793978-1794000 CAGCAACACTGCAGACACGGGGG + Intronic
901819633 1:11819378-11819400 CTCCCCCACTGCACATACGGAGG - Intronic
902503583 1:16925839-16925861 CACACCCGCTGCAGACCCTGGGG - Intronic
910236867 1:85046100-85046122 AACACCCACAGCAGACAGGGTGG + Intronic
920537666 1:206749864-206749886 AAAGCCCACTGCAGACTCCGAGG - Intergenic
921171951 1:212558470-212558492 CCCGCCGACTGCTGACGCGGTGG + Intergenic
1062875585 10:940555-940577 CATGCCCACTTCAGGCACTGGGG - Intergenic
1071609049 10:87018279-87018301 CAGGCCCACCGCAGCCTCGGGGG - Intergenic
1072581637 10:96745048-96745070 CACTCCCTCTGAAGACATGGAGG + Intergenic
1076526713 10:131116751-131116773 CACTCCTACGGCAGACCCGGGGG - Intronic
1077352789 11:2100625-2100647 CCCGCCCAGTGCAGAGAGGGAGG + Intergenic
1077463801 11:2723933-2723955 CACGCCCACGGCAGATACAAAGG - Intronic
1078098299 11:8313640-8313662 CACCCCCACTGCACCCAGGGAGG - Intergenic
1081512536 11:43790452-43790474 CATATCCCCTGCAGACACGGGGG - Intronic
1083073386 11:60010889-60010911 GAGGCCCACTTCAGACACAGGGG + Intergenic
1084258056 11:67955875-67955897 CGCGCCCACCGCGGACACGCCGG + Intergenic
1087921778 11:103875408-103875430 CACCCCCCCTGCTGAGACGGAGG + Intergenic
1089213567 11:116822146-116822168 CCCACCCTCTGCAGACAAGGAGG - Intronic
1090074463 11:123571327-123571349 CACGCCCACTGCAGACACGGTGG - Intronic
1094245969 12:28293877-28293899 CAGGCGCACTGCAGACAAGGAGG - Intronic
1095546062 12:43371719-43371741 CACTCCTACTACAGACACAGTGG - Intronic
1096230525 12:49894374-49894396 CTCCACCACCGCAGACACGGTGG + Intronic
1096676235 12:53227567-53227589 CCCGCCCACTGCAGACCCCAGGG - Exonic
1100607511 12:96163651-96163673 CACACCCACTGCAACCATGGTGG - Intergenic
1101716592 12:107318248-107318270 CACGCCCCCGGCGGACACCGAGG - Intergenic
1103926633 12:124427048-124427070 CCCTCCCACTGCAGAGAAGGCGG - Intronic
1104442171 12:128802572-128802594 CCCGCCCCCTGCAGACACTTTGG - Intronic
1104727351 12:131086164-131086186 CTGGCCCAGTGCAGACACTGCGG - Intronic
1104953293 12:132451901-132451923 CCCTCCCACTGCAGCCAGGGTGG - Intergenic
1106006938 13:25779430-25779452 CACCCCCAGTGCAGACACACAGG - Intronic
1106804317 13:33290469-33290491 CATGCCCAGTGCAGACAAGCTGG + Intronic
1108595647 13:51946352-51946374 CACGCCCACGGCTGTCATGGTGG - Exonic
1112041828 13:95554458-95554480 CACTCTCACTGCAGACATGTAGG - Intronic
1115822387 14:37225632-37225654 TGCTCCCACTGCAGACCCGGAGG - Intronic
1116130911 14:40854960-40854982 CACAGGCACTGCAGCCACGGAGG + Intergenic
1117601715 14:57382608-57382630 CACACCCCCTGCAGATAAGGGGG + Intergenic
1121565556 14:94906884-94906906 CCCTCCCACTGCAGAAACAGAGG - Intergenic
1122278268 14:100606355-100606377 CACGCCCACAGAGGACACGCAGG - Intergenic
1122699127 14:103575466-103575488 CACTCCCACTGCAGGCACCGTGG - Intronic
1125599216 15:40906498-40906520 AGTGCCCACTGCAGACTCGGCGG - Intergenic
1128720363 15:69943377-69943399 TGGGCCCACTGCAGACAGGGCGG + Intergenic
1129388112 15:75206950-75206972 CACTCCCACTGCAGCCTCTGGGG + Exonic
1129868628 15:78927048-78927070 CATGCACACTGCAGTCACGAAGG + Intronic
1134812053 16:17176097-17176119 CACAGCCACTGCAGCCACAGTGG + Intronic
1134845095 16:17433476-17433498 GATGGCCACTGCAGACACTGTGG - Intronic
1146275891 17:31515353-31515375 CACGCCAACAGCAGAGACTGTGG - Intronic
1146957020 17:36941953-36941975 CTCTCCCCCTCCAGACACGGCGG + Intronic
1147565914 17:41536379-41536401 CACGCTCACTCCACACAGGGAGG + Intergenic
1147893487 17:43734200-43734222 CACACCCTCTGCAGACACTAGGG + Intergenic
1149856201 17:60085132-60085154 CACACCCATTGCTGACACAGTGG + Intergenic
1150125447 17:62631936-62631958 GACCCCCACTGGAGACACGGTGG - Intronic
1152263273 17:79278561-79278583 CACGCCCACAGCACACAGGCAGG - Intronic
1152275257 17:79352836-79352858 CATTCCCAGTGCAGACAGGGTGG - Intronic
1152554825 17:81047789-81047811 CATGCCCACAGCACACACAGGGG + Intronic
1152664473 17:81559333-81559355 CACGGCCACTGCAGCCATGTGGG - Exonic
1152784039 17:82238868-82238890 CAAGCCTCCTGCAGACTCGGGGG + Exonic
1155902686 18:31410908-31410930 CAAGCCCGCAGCAGCCACGGCGG + Intronic
1161380230 19:3960944-3960966 CAGGCCCACTCCACCCACGGAGG - Intronic
1161698339 19:5782540-5782562 CACAGCCACTGCAGGCAGGGCGG - Intergenic
1162056951 19:8070468-8070490 CACCCCCACTGCAGACATTTAGG - Intronic
1165095021 19:33405596-33405618 GGCGGCCCCTGCAGACACGGTGG + Intronic
1165387131 19:35517054-35517076 CACGCCTATTCCAGACACTGGGG + Intergenic
1165828888 19:38720731-38720753 CCCGCCCAGTGCAGCCACCGAGG - Intronic
1165831013 19:38730329-38730351 CACGCCCGACGCAGACCCGGAGG - Exonic
1167073202 19:47232467-47232489 CTGGCCCACTGCACACACGTCGG + Intronic
926235984 2:11044355-11044377 CAGGCCCACCTCAGACACTGGGG - Intergenic
926739897 2:16102469-16102491 CACCCCCACTGCAGCCACTCTGG + Intergenic
927110276 2:19859482-19859504 CACCCACACTGCAGACGCAGGGG + Intergenic
927554867 2:24024282-24024304 CACGCCCCCTGCAGCCAGCGAGG + Exonic
929544841 2:42849092-42849114 CACGCCCAGTGAAAACACTGGGG - Intergenic
935353707 2:102178238-102178260 CAGGCCCACTGCAGAGATGGTGG + Exonic
938070431 2:128305513-128305535 CCCGCCCACTGCAGACCCCAGGG - Intronic
944721028 2:202423375-202423397 GGCTCCCACTTCAGACACGGGGG + Intronic
944879497 2:203997540-203997562 CAAGGCCACTTCAGACAAGGAGG - Intergenic
1168891812 20:1299870-1299892 CACCCCCACTGCGTACACGTGGG - Intronic
1171969038 20:31551961-31551983 CACTCCCACTGGAGAGATGGAGG + Intronic
1173586447 20:44186738-44186760 CACGCCCTCTGCACCCACGCTGG - Exonic
1173704170 20:45097995-45098017 CGCGGCCACCGCAGCCACGGCGG + Exonic
1175766254 20:61594732-61594754 CCAGCGCTCTGCAGACACGGCGG - Intronic
1178352450 21:31882023-31882045 CATGCCTACTTCAGAGACGGTGG + Intronic
1180129866 21:45820513-45820535 CACGCACACTGCAGACCGTGTGG - Intronic
1183431332 22:37767696-37767718 CACCCCCCCTGCAGACTCTGAGG - Intronic
1184567113 22:45298703-45298725 CAGGGCCACTGAACACACGGTGG + Intergenic
950011886 3:9729831-9729853 CAGGCCCTCTGCAGGCAAGGAGG - Exonic
950284759 3:11735905-11735927 CAACCCCACTGCAGCCACGCTGG - Intergenic
954634569 3:52064589-52064611 CACCCCATCTGCTGACACGGAGG + Intergenic
961324355 3:126101510-126101532 GGCGCCCACTGCAGTCACGCTGG - Intronic
961804282 3:129477585-129477607 CACTCCCACTACAGACCAGGTGG - Intronic
961873302 3:130003191-130003213 CACGCGCACCGCGGACACGCCGG + Intergenic
968846568 4:3045705-3045727 CACGGCCACTGCAGGCTCTGTGG + Intergenic
969425404 4:7121227-7121249 CTCGCCCACACCAGGCACGGTGG + Intergenic
971111380 4:23589884-23589906 CACTCCTACTACAGGCACGGGGG - Intergenic
974147599 4:57966652-57966674 CCCACCAACTCCAGACACGGTGG + Intergenic
984711699 4:182890753-182890775 CTCTCCCACTGCACACAGGGTGG - Exonic
985702253 5:1380612-1380634 CACGGCCAGAGCCGACACGGAGG + Intergenic
988459809 5:31424394-31424416 AAAGCTCACTGCAGACAGGGAGG + Intronic
990187068 5:53220734-53220756 CACTCCAACTGCAGTCAAGGTGG - Intergenic
997638912 5:135435696-135435718 GCAGCCCACTGCAGACACAGAGG - Intergenic
998433690 5:142088691-142088713 CAGCCCCACTGCAGATACGCCGG - Intergenic
1002534187 5:179867261-179867283 CCCACCTACAGCAGACACGGAGG + Intronic
1006192920 6:32220575-32220597 CCCCCTCACTGCAGAAACGGGGG - Exonic
1006746981 6:36349797-36349819 CACGCTCACTGTGGACACTGTGG + Intergenic
1008652010 6:53573493-53573515 CACGCCCACTGCACTTCCGGTGG + Intronic
1010212524 6:73373428-73373450 CACACCCACTGTAGAGACAGAGG + Intronic
1019260958 7:81787-81809 CTCGCCCACAGCAGACACGGAGG - Intergenic
1024043257 7:45571087-45571109 CAAACCCACTGCAGACTGGGTGG + Intergenic
1029113539 7:98225007-98225029 CAGGCCCACTGCAGGGACGGGGG + Exonic
1029303455 7:99601901-99601923 CTTGCCCAGTGCAGACACTGGGG - Intronic
1029586142 7:101472817-101472839 CACCCCCTCTGCAGATCCGGAGG - Intronic
1032305462 7:130729912-130729934 CATGCACACTGCAGGCAGGGAGG + Intergenic
1034210493 7:149358547-149358569 CAAGCCTACTGGAGACAGGGGGG + Intergenic
1034265975 7:149780823-149780845 CCCACCCACTGCACACTCGGCGG - Intergenic
1034977802 7:155458256-155458278 CACGCCCTCGGAAGACTCGGCGG + Exonic
1035277743 7:157758147-157758169 CCGGCCCACTGCAGCCACGCCGG - Intronic
1045277929 8:100722968-100722990 AACGTCCAGTGAAGACACGGAGG - Intergenic
1046876463 8:119260017-119260039 CACCTCCACTGCTGACACTGAGG - Intergenic
1048990906 8:139759680-139759702 AACACGAACTGCAGACACGGGGG + Intronic
1049082976 8:140457379-140457401 CACACCCGCTGAAGACTCGGCGG - Intronic
1049206845 8:141367475-141367497 CACACCCACTGGAGACAGAGGGG + Intergenic
1049376303 8:142290925-142290947 GAAGCCCAGTGCAGACACAGAGG + Intronic
1052767003 9:32651205-32651227 CACGTCCACTGCAGAGGTGGTGG - Intergenic
1054797895 9:69319479-69319501 CACACACACTGCACACATGGAGG + Intergenic
1054909198 9:70438477-70438499 CAAGCCCAATGCTGACACAGCGG - Intergenic
1057761812 9:97880802-97880824 CACCCCCACTGCAGAAAAGATGG + Intergenic
1057995715 9:99820385-99820407 CACTTCCAATTCAGACACGGTGG - Intergenic
1060190875 9:121591709-121591731 CCAGCCCAGTGCAGACACTGTGG - Intronic
1060206434 9:121685263-121685285 CACTCCCTCTGCAGAAAAGGGGG - Intronic
1060518860 9:124282638-124282660 CACGCCCACTGAATACTCAGGGG + Intronic
1060937039 9:127521923-127521945 CATCCCCACTGCACACATGGGGG + Intronic
1061970662 9:134043363-134043385 CAGGCTCACTGAAGACAGGGAGG + Intronic
1062614753 9:137391294-137391316 CCCGCCCAGTGTGGACACGGCGG - Intronic
1203783494 EBV:114448-114470 CACGTACACAGCTGACACGGCGG + Intergenic
1185884960 X:3774254-3774276 CAGGCCCACTACCGACACTGAGG + Intergenic
1190103632 X:47542684-47542706 CAAACCCATTGCAGACACGGAGG + Intergenic
1196489294 X:116248222-116248244 TACCCCCACTGCAGATAAGGTGG + Intergenic
1201407039 Y:13659929-13659951 TACCCCCACTGCAGTCAAGGTGG - Intergenic