ID: 1090074486

View in Genome Browser
Species Human (GRCh38)
Location 11:123571449-123571471
Sequence CAGCTAGACCTAACTATAGG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 60
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 55}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090074480_1090074486 16 Left 1090074480 11:123571410-123571432 CCTCATCCTCTTTTTCTACTTCC 0: 1
1: 0
2: 10
3: 241
4: 2009
Right 1090074486 11:123571449-123571471 CAGCTAGACCTAACTATAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090074483_1090074486 -5 Left 1090074483 11:123571431-123571453 CCCTTTTCTCAAGGACATCAGCT 0: 1
1: 0
2: 2
3: 26
4: 266
Right 1090074486 11:123571449-123571471 CAGCTAGACCTAACTATAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090074481_1090074486 10 Left 1090074481 11:123571416-123571438 CCTCTTTTTCTACTTCCCTTTTC 0: 1
1: 0
2: 13
3: 157
4: 1521
Right 1090074486 11:123571449-123571471 CAGCTAGACCTAACTATAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090074479_1090074486 28 Left 1090074479 11:123571398-123571420 CCTGAAGAGAGTCCTCATCCTCT 0: 1
1: 0
2: 1
3: 26
4: 166
Right 1090074486 11:123571449-123571471 CAGCTAGACCTAACTATAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 55
1090074484_1090074486 -6 Left 1090074484 11:123571432-123571454 CCTTTTCTCAAGGACATCAGCTA 0: 1
1: 0
2: 1
3: 22
4: 291
Right 1090074486 11:123571449-123571471 CAGCTAGACCTAACTATAGGAGG 0: 1
1: 0
2: 0
3: 4
4: 55

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090074486 Original CRISPR CAGCTAGACCTAACTATAGG AGG Intronic
914826593 1:151142008-151142030 CAGCTAGACCAAACCTTAGCAGG - Intronic
917535380 1:175870806-175870828 CAGCTTGATCTTACTATCGGTGG + Intergenic
1068640080 10:59394289-59394311 CAACTACACCTAACAATAGCAGG - Intergenic
1074974600 10:118569846-118569868 CAGCTGGTCCTAACCATGGGTGG + Intergenic
1082931642 11:58613739-58613761 CTGCCAGACCTAAATATAAGTGG - Intronic
1084314578 11:68337700-68337722 GAGGTAGACCTGACTATGGGTGG - Intronic
1084761257 11:71272593-71272615 CAGCCAGGCCTAACTCAAGGAGG + Intergenic
1089084940 11:115809026-115809048 CAGCTCGAACTAACTTTGGGAGG - Intergenic
1090074486 11:123571449-123571471 CAGCTAGACCTAACTATAGGAGG + Intronic
1093030239 12:14281766-14281788 CAGATAGAGATATCTATAGGTGG + Intergenic
1095578498 12:43766956-43766978 CAGCTAGACCTATTTAGATGTGG + Intronic
1103314671 12:120042927-120042949 CTGCTAAACCTAACCAGAGGTGG + Intronic
1104524980 12:129512701-129512723 CAGCTTGTGCTAACTATAGCAGG + Intronic
1127354346 15:58183826-58183848 CAGCAAGAGCTAAGTATAAGGGG - Intronic
1128391976 15:67188461-67188483 CAGGTAGACCTGACTATATCAGG - Intronic
1133294941 16:4747106-4747128 CAGCAAGACCTCACCACAGGCGG - Intronic
1133688824 16:8193132-8193154 CAGCTACACCTAACTTCATGGGG + Intergenic
1139068047 16:63343459-63343481 AAACCAGACCTAACTCTAGGAGG - Intergenic
1149084426 17:52697324-52697346 TAGCTAGGCCTAACTATAGACGG - Intergenic
1150233940 17:63577267-63577289 CAACTATACCTAACTTTGGGGGG + Intronic
1153569106 18:6450722-6450744 CCTGTAGTCCTAACTATAGGAGG + Intergenic
1158302949 18:56073174-56073196 CAGTTAGACCTAATTATCTGTGG - Intergenic
928361236 2:30663861-30663883 CAGCTATACTTAGCTATAGCTGG + Intergenic
929752865 2:44735264-44735286 CAGCTAGACCGAAGTACATGTGG - Intronic
933967636 2:87442971-87442993 CAGCCAGACCTAATGATAGGTGG + Intergenic
936326161 2:111507525-111507547 CAGCCAGACCTAATGATAGGTGG - Intergenic
939025883 2:137013634-137013656 CAGCAAAACCTCACTAAAGGTGG - Intronic
940360996 2:152795468-152795490 CAGCTAAATCTAAATATGGGAGG - Intergenic
941116983 2:161482865-161482887 CAACAAAACCTAACTATATGCGG + Intronic
942944580 2:181658371-181658393 CAGAAAGAGCTAACTATAGCAGG + Intronic
943248763 2:185490032-185490054 AAACAAGACCTAACTATATGCGG - Intergenic
948343196 2:237271638-237271660 AAGCTAGGACTAACTGTAGGAGG - Intergenic
1170233006 20:14070951-14070973 CAGCAAAAGCTAACTGTAGGAGG - Intronic
949682281 3:6527954-6527976 CAGCTAGACCTGACTGTGGATGG + Intergenic
955547906 3:60051412-60051434 CACCTAGACATAACTTAAGGAGG + Intronic
959070901 3:101701264-101701286 TAGCTAGTCCTGTCTATAGGTGG - Intergenic
968310710 3:197681144-197681166 CAGCTTGACCTTCCTATAGAGGG + Exonic
977685326 4:99840891-99840913 AAGCTAGACTTAACTATGGCTGG + Intronic
978748467 4:112221754-112221776 CAGCCAGGCCAAACTATAGGAGG - Intergenic
983332108 4:166343620-166343642 TAGGCCGACCTAACTATAGGAGG + Intergenic
983612903 4:169669750-169669772 CAACTTTACCTAACTATATGAGG - Intronic
987842798 5:23242362-23242384 AAATTGGACCTAACTATAGGTGG + Intergenic
989747633 5:44849303-44849325 GAGCTAGACCTAAATATATTAGG - Intergenic
992350075 5:75920020-75920042 CTGCTAGACCAAAACATAGGTGG + Intergenic
1006484593 6:34328260-34328282 CAGTTAGACCTAAATAAAGATGG - Intronic
1007135807 6:39520875-39520897 CAGCTAGACCTAACTGTCATAGG + Intronic
1010936099 6:81863644-81863666 CAGTAAGCGCTAACTATAGGTGG + Intergenic
1011374057 6:86671234-86671256 CAACAAGACCTAAGAATAGGGGG - Intergenic
1012238509 6:96845614-96845636 AAGCAAGACCTAACTACATGTGG + Intergenic
1017686615 6:156919950-156919972 CTGCTATAACTAACTGTAGGTGG + Intronic
1017842153 6:158231393-158231415 CTGCTATTCCTAACTATATGGGG + Intergenic
1033057338 7:138070246-138070268 CAGATAGACCTGACTTTGGGGGG + Intronic
1038410356 8:27353763-27353785 CACTTAGACCTGACTATGGGTGG + Intronic
1048789090 8:138083933-138083955 CAGTGATACCTAACTATAAGAGG - Intergenic
1053015830 9:34661525-34661547 CAGCAAGACAGAATTATAGGTGG - Exonic
1058665236 9:107307946-107307968 CAGCTTAACCTGACTCTAGGTGG - Intronic
1189563979 X:42220332-42220354 CAGCTATACTTAACTATACAGGG - Intergenic
1189756824 X:44280692-44280714 CAGCTAGACCATACAATGGGGGG + Intronic
1195052578 X:101111014-101111036 CAGCCTGACCTAATTAGAGGTGG + Intronic
1199569546 X:149253656-149253678 CAGCTTGACCCCACCATAGGAGG - Intergenic