ID: 1090076223

View in Genome Browser
Species Human (GRCh38)
Location 11:123581532-123581554
Sequence GAGCCTGTCCACTGTGGGCA GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 249
Summary {0: 1, 1: 0, 2: 1, 3: 26, 4: 221}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090076223_1090076234 4 Left 1090076223 11:123581532-123581554 CCCTGCCCACAGTGGACAGGCTC 0: 1
1: 0
2: 1
3: 26
4: 221
Right 1090076234 11:123581559-123581581 GCTGCTTTGGACGTGGCTGGAGG 0: 1
1: 0
2: 1
3: 14
4: 212
1090076223_1090076237 7 Left 1090076223 11:123581532-123581554 CCCTGCCCACAGTGGACAGGCTC 0: 1
1: 0
2: 1
3: 26
4: 221
Right 1090076237 11:123581562-123581584 GCTTTGGACGTGGCTGGAGGGGG 0: 1
1: 0
2: 1
3: 21
4: 234
1090076223_1090076236 6 Left 1090076223 11:123581532-123581554 CCCTGCCCACAGTGGACAGGCTC 0: 1
1: 0
2: 1
3: 26
4: 221
Right 1090076236 11:123581561-123581583 TGCTTTGGACGTGGCTGGAGGGG 0: 1
1: 0
2: 0
3: 15
4: 193
1090076223_1090076233 1 Left 1090076223 11:123581532-123581554 CCCTGCCCACAGTGGACAGGCTC 0: 1
1: 0
2: 1
3: 26
4: 221
Right 1090076233 11:123581556-123581578 GGGGCTGCTTTGGACGTGGCTGG 0: 1
1: 2
2: 3
3: 10
4: 195
1090076223_1090076232 -3 Left 1090076223 11:123581532-123581554 CCCTGCCCACAGTGGACAGGCTC 0: 1
1: 0
2: 1
3: 26
4: 221
Right 1090076232 11:123581552-123581574 CTCGGGGGCTGCTTTGGACGTGG 0: 1
1: 0
2: 1
3: 4
4: 120
1090076223_1090076238 8 Left 1090076223 11:123581532-123581554 CCCTGCCCACAGTGGACAGGCTC 0: 1
1: 0
2: 1
3: 26
4: 221
Right 1090076238 11:123581563-123581585 CTTTGGACGTGGCTGGAGGGGGG 0: 1
1: 0
2: 1
3: 16
4: 242
1090076223_1090076235 5 Left 1090076223 11:123581532-123581554 CCCTGCCCACAGTGGACAGGCTC 0: 1
1: 0
2: 1
3: 26
4: 221
Right 1090076235 11:123581560-123581582 CTGCTTTGGACGTGGCTGGAGGG 0: 1
1: 0
2: 1
3: 17
4: 168
1090076223_1090076231 -9 Left 1090076223 11:123581532-123581554 CCCTGCCCACAGTGGACAGGCTC 0: 1
1: 0
2: 1
3: 26
4: 221
Right 1090076231 11:123581546-123581568 GACAGGCTCGGGGGCTGCTTTGG 0: 1
1: 0
2: 0
3: 11
4: 174
1090076223_1090076239 25 Left 1090076223 11:123581532-123581554 CCCTGCCCACAGTGGACAGGCTC 0: 1
1: 0
2: 1
3: 26
4: 221
Right 1090076239 11:123581580-123581602 GGGGGGACCCATTTTTCCTGTGG 0: 1
1: 0
2: 1
3: 6
4: 109

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090076223 Original CRISPR GAGCCTGTCCACTGTGGGCA GGG (reversed) Intronic