ID: 1090077579

View in Genome Browser
Species Human (GRCh38)
Location 11:123589075-123589097
Sequence GCTGCTCATGTGACACATTC CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 12, 4: 128}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090077579_1090077580 -10 Left 1090077579 11:123589075-123589097 CCGGAATGTGTCACATGAGCAGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1090077580 11:123589088-123589110 CATGAGCAGCGTGTCACGTGAGG 0: 1
1: 0
2: 0
3: 4
4: 53
1090077579_1090077584 27 Left 1090077579 11:123589075-123589097 CCGGAATGTGTCACATGAGCAGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1090077584 11:123589125-123589147 TTCTGCTTGCGGCATCATGTTGG 0: 1
1: 0
2: 21
3: 83
4: 199
1090077579_1090077581 -5 Left 1090077579 11:123589075-123589097 CCGGAATGTGTCACATGAGCAGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1090077581 11:123589093-123589115 GCAGCGTGTCACGTGAGGTCAGG 0: 1
1: 0
2: 3
3: 108
4: 952
1090077579_1090077586 29 Left 1090077579 11:123589075-123589097 CCGGAATGTGTCACATGAGCAGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1090077586 11:123589127-123589149 CTGCTTGCGGCATCATGTTGGGG 0: 1
1: 0
2: 0
3: 6
4: 73
1090077579_1090077582 0 Left 1090077579 11:123589075-123589097 CCGGAATGTGTCACATGAGCAGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1090077582 11:123589098-123589120 GTGTCACGTGAGGTCAGGTGTGG 0: 1
1: 8
2: 58
3: 114
4: 404
1090077579_1090077585 28 Left 1090077579 11:123589075-123589097 CCGGAATGTGTCACATGAGCAGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1090077585 11:123589126-123589148 TCTGCTTGCGGCATCATGTTGGG 0: 1
1: 0
2: 1
3: 5
4: 69
1090077579_1090077583 16 Left 1090077579 11:123589075-123589097 CCGGAATGTGTCACATGAGCAGC 0: 1
1: 0
2: 0
3: 12
4: 128
Right 1090077583 11:123589114-123589136 GGTGTGGAGTCTTCTGCTTGCGG 0: 1
1: 0
2: 2
3: 51
4: 377

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090077579 Original CRISPR GCTGCTCATGTGACACATTC CGG (reversed) Intronic
901881336 1:12195614-12195636 GGTGGTCATGTGACACTGTCTGG - Intronic
907973281 1:59405809-59405831 GCTCCTCATGTCACACAGTGAGG + Intronic
910089298 1:83443253-83443275 GCTACTCATGTTACACTGTCTGG - Intergenic
917040785 1:170803907-170803929 GGTGCTCATGTGAGTCAGTCAGG - Intergenic
921171418 1:212553109-212553131 GCTGGTCATTTTACCCATTCCGG - Intergenic
921290582 1:213653113-213653135 ACAGTCCATGTGACACATTCTGG + Intergenic
922552413 1:226505690-226505712 GCTTCTTATGCAACACATTCTGG + Intergenic
1063639254 10:7814391-7814413 TCTGTTCCAGTGACACATTCAGG - Intergenic
1064107281 10:12510711-12510733 GCCGCTCCTGTGATTCATTCAGG - Intronic
1064444137 10:15378775-15378797 GCTGCTCCTGTGCCCCAGTCAGG + Intergenic
1066441787 10:35446607-35446629 GCTGCTCATGAAACACAAACTGG - Intronic
1067569703 10:47362472-47362494 CCTGCTGATGTGATACATTGTGG + Intergenic
1070873221 10:79776815-79776837 CTTGCTGATGTGACCCATTCTGG + Intergenic
1071019991 10:81041938-81041960 GGTGCTCCTTTGACACATTTGGG - Intergenic
1071640146 10:87298965-87298987 CTTGCTGATGTGACCCATTCTGG + Intergenic
1071655086 10:87438980-87439002 CTTGCTGATGTGACCCATTCTGG - Intergenic
1075484466 10:122810948-122810970 TCTGCTCATGTTTCATATTCAGG + Intergenic
1076304840 10:129458557-129458579 TTTGCAAATGTGACACATTCGGG + Intergenic
1076730192 10:132434670-132434692 GCTGCTCATCTGACACCTGAGGG - Intergenic
1077433809 11:2528638-2528660 GCTGCTCACGGCCCACATTCAGG - Intronic
1077578150 11:3399763-3399785 GCTGCTCATTTAGCACAGTCCGG - Intergenic
1090077579 11:123589075-123589097 GCTGCTCATGTGACACATTCCGG - Intronic
1090861917 11:130661635-130661657 GCTGCTGAGGTGTGACATTCAGG + Intergenic
1091004412 11:131939691-131939713 GCTGCTCATCTGGAACAATCTGG + Intronic
1091403616 12:195819-195841 GCTGCTCTTGTGGCACTCTCAGG - Intronic
1099468377 12:83015864-83015886 GCTGGTCATGTGCCAGGTTCTGG + Intronic
1099606480 12:84808497-84808519 GATGAACATATGACACATTCAGG - Intergenic
1100174133 12:92010240-92010262 GCTTATCATGTGACAGAGTCTGG + Intronic
1101546916 12:105722508-105722530 GCTGGCCATGTGACACAGTTTGG + Intergenic
1102561462 12:113765141-113765163 GCTGCACAGGTGGCACACTCTGG - Intergenic
1103516023 12:121508958-121508980 GCTGCACATGTCACACCTGCTGG + Intronic
1106782835 13:33076870-33076892 GCTGCTGCTGTTACACATGCTGG - Intergenic
1109234309 13:59796324-59796346 GCTGAACATGTCACACATTAAGG + Intronic
1111054734 13:82934163-82934185 GCTGTGCATCTGGCACATTCTGG + Intergenic
1111930622 13:94509446-94509468 TGTGACCATGTGACACATTCTGG + Intergenic
1112380341 13:98882918-98882940 GCTACTGATGTGAGACATCCAGG + Intronic
1113923813 13:113929379-113929401 GCTGCACATGTGGCAGCTTCAGG + Intergenic
1118911351 14:70064579-70064601 TTGGCTCATGTCACACATTCTGG + Intronic
1120754742 14:88232001-88232023 GCTGCTCATGAGAGCCTTTCTGG + Intronic
1121326509 14:93023238-93023260 GGTGATCATGTGACTCGTTCTGG + Intronic
1121451056 14:94008673-94008695 GCTGGTCATGGGACAGCTTCGGG + Intergenic
1121805982 14:96823242-96823264 CCTTCTCTTTTGACACATTCTGG - Intronic
1122126227 14:99580022-99580044 CCTGCCCATGTGACTCACTCCGG - Intronic
1127618376 15:60709538-60709560 GCTGCTCATCTGACAGAATCTGG - Intronic
1127760808 15:62137516-62137538 GATGCTCATGTGAAACTCTCAGG + Intergenic
1130328212 15:82898582-82898604 GCTGTTCATTGAACACATTCTGG + Intronic
1132809036 16:1788864-1788886 GCTGCTGGTGCGACACATCCTGG - Exonic
1133762104 16:8807388-8807410 GCTGCTCAGGTGGCACCTGCCGG - Intronic
1134193704 16:12142212-12142234 GCTGCATATGTGACCCACTCTGG + Intronic
1137863983 16:51874906-51874928 GGTGGCCATGTGACAGATTCTGG - Intergenic
1137983349 16:53088214-53088236 GATGCTCATGGGACCCAATCAGG - Intronic
1138050747 16:53774762-53774784 GCCGCTCATCTGTCACACTCGGG + Intronic
1139354465 16:66359329-66359351 GTTACTCATGTGACCCACTCCGG + Intergenic
1146656964 17:34640108-34640130 GCTGCTTCTGGGACACATGCTGG - Intergenic
1148823202 17:50372960-50372982 GCTGGTCACGTGACACATCCTGG - Intronic
1150293552 17:63995840-63995862 GCTGCTCCTGTGCCACCTTCTGG + Intergenic
1151381217 17:73727079-73727101 GATGCCCATGTGACTCAGTCAGG - Intergenic
1152179091 17:78806719-78806741 GATGCTCATGTGACTCATGGAGG - Intronic
1152579334 17:81159171-81159193 GCTGCTCATTTGACACAGGTGGG + Intronic
1154983385 18:21523183-21523205 GAGTCTCATGTAACACATTCAGG - Exonic
1163617801 19:18340215-18340237 GCTGCTCCTGTGACCCCTTGAGG + Intergenic
1165182786 19:33987221-33987243 GCAGCTCATGTGAAACTTTTAGG - Intergenic
1166459207 19:42971267-42971289 GCTGGTCATGAGAGACATTCGGG - Intronic
1166476153 19:43126534-43126556 GCTGGTCATGAGAGACATTTGGG - Intronic
927298788 2:21486117-21486139 ACTGCTCCTGAGACACATTTTGG + Intergenic
927441732 2:23123483-23123505 GCTGTTCATGGACCACATTCAGG - Intergenic
931132572 2:59353688-59353710 GCAGCTGATGTGAAACATTCTGG + Intergenic
931332007 2:61296799-61296821 CCTGCTCATCTGAGATATTCTGG + Exonic
931584859 2:63814261-63814283 GATAGTCATGTGACACATTCTGG + Intronic
933509180 2:83218181-83218203 ACTACTCATGTTACACATTTTGG + Intergenic
937808617 2:126174743-126174765 GCAGCTTAAGAGACACATTCAGG + Intergenic
939025028 2:137002346-137002368 GCAGCTCATGTGACCCAGTCTGG - Intronic
939887188 2:147693831-147693853 TCTGCCCATGTGAGACATTGAGG - Intergenic
942886760 2:180934841-180934863 GCAGTTCATGTGAAACAATCTGG - Intergenic
943690396 2:190863750-190863772 GCTGCTCATCTGAGAGATACTGG + Intergenic
1169411799 20:5377291-5377313 GCTGCTTCTGTGGCACACTCAGG + Intergenic
1170556457 20:17518854-17518876 GGTGGTCATGTGACCCATGCTGG - Intronic
1172025752 20:31947208-31947230 CCTGCTCATGAGTGACATTCTGG + Intronic
1172193967 20:33079439-33079461 CCAGCTCATGTGACACCATCTGG + Intergenic
1173528122 20:43748320-43748342 GCTGCTCAGGGGACAGTTTCAGG - Intergenic
1175488788 20:59364791-59364813 GCTGCTCATTTTACACATGAGGG + Intergenic
1178414613 21:32393431-32393453 GCTCTTCATGCGACACCTTCAGG - Exonic
1181153972 22:20905942-20905964 GCTTAGCATGTGACTCATTCTGG + Intergenic
1181714708 22:24716211-24716233 GCTTCTCATGCCACAGATTCTGG - Intergenic
1182298663 22:29326149-29326171 CCTGCTCATGTGGCACTTCCTGG - Intergenic
1182305605 22:29365767-29365789 GCTGTGCCTGTGACACATTTGGG - Intronic
1182312879 22:29421705-29421727 GCTGTGCCTGTGACACATTTGGG - Intronic
1183564252 22:38601825-38601847 GCTGCTCAGGTGGGACAATCTGG + Intronic
1185190967 22:49435796-49435818 GCTGGCCATGTGACCCATGCTGG + Intronic
955330136 3:58040522-58040544 CCTGCTCTTGTCACACAGTCTGG + Intronic
956436717 3:69241333-69241355 GCTGCTTATGTGTCCCCTTCTGG + Intronic
964234551 3:154509904-154509926 ACTACACATGTGACACATTCTGG + Intergenic
965752850 3:171994773-171994795 GCTGGTCAAGTTGCACATTCAGG - Intergenic
968993959 4:3933648-3933670 GCTGCTCATTTAGCACAGTCCGG - Intergenic
970808977 4:20068914-20068936 CCTGCCCATATGACCCATTCAGG + Intergenic
973189964 4:47375728-47375750 GCAGGTTATGTGACTCATTCTGG - Intronic
975585483 4:75943828-75943850 GGTGATCATGTTAAACATTCTGG - Intronic
981665627 4:147222887-147222909 CCTGCTCATGTGACTCCTTGAGG + Intergenic
983371692 4:166868115-166868137 GCTACTCTAGTTACACATTCTGG + Intronic
994177457 5:96726992-96727014 GCTGCCCATCAGCCACATTCTGG + Intronic
995248859 5:109966318-109966340 GCTCCTAATATGACACTTTCTGG + Intergenic
999772705 5:154787533-154787555 GCAGCTCATCTGAGCCATTCTGG + Intronic
1001770014 5:174287925-174287947 GGAGGTCATGTGACTCATTCGGG - Intergenic
1004588530 6:17026401-17026423 TCTCATCATGTGACACATACTGG + Intergenic
1005880731 6:30058023-30058045 TCTGCCCAAGTGACACATTCAGG - Intergenic
1007567644 6:42864703-42864725 GCTGCTCATGAGACACAGTTTGG + Exonic
1010099276 6:72084176-72084198 CATGATCACGTGACACATTCTGG + Intronic
1010441319 6:75898487-75898509 GCTACTCATGTAACAGGTTCTGG - Intronic
1013135713 6:107280975-107280997 TGTGATCATGTGACACAGTCTGG + Intronic
1013624549 6:111924271-111924293 CCAGATCATGTGTCACATTCTGG + Intergenic
1014148884 6:118030442-118030464 GTTTCTCATCTGACCCATTCTGG + Intronic
1018484109 6:164222961-164222983 GCTGCTCAGGTGCCACCTGCAGG - Intergenic
1018842275 6:167525952-167525974 TGTGCTGATGTGACACATTGTGG - Intergenic
1019990736 7:4688910-4688932 GCTGCTAATGTTACAAATTGTGG - Intronic
1020316579 7:6909561-6909583 GCTGCTCATTTAGCACAGTCTGG - Intergenic
1022955372 7:35375414-35375436 GTTGCTAATGTAACACATTCAGG + Intergenic
1023280190 7:38561359-38561381 GCTGTACATATGACACTTTCTGG - Intronic
1024427379 7:49242104-49242126 GCTGCTATGGTGAAACATTCAGG + Intergenic
1027306159 7:76899688-76899710 GCTACTCATGTTACACTGTCTGG - Intergenic
1028446780 7:90933414-90933436 GTTGCTCATGTGAAACACTAGGG + Intronic
1029118490 7:98251003-98251025 GCTCCTCATGGGCCACTTTCTGG + Intronic
1032975103 7:137213900-137213922 TTTGCTGATGTGACAAATTCTGG - Intergenic
1034498886 7:151437599-151437621 GGTGGTCTTGTGGCACATTCTGG - Intronic
1035083100 7:156233637-156233659 GCTGCTTATGTGATAAAGTCAGG + Intergenic
1037986910 8:23295852-23295874 GCCTCTCATGTGACACATGTGGG - Intronic
1038506348 8:28088334-28088356 GCAGCTCATGTAACACCTTGTGG - Intergenic
1039190761 8:34971609-34971631 GCTGCTCCTGTGTCACTTACAGG - Intergenic
1040883296 8:52231780-52231802 GCTTCTTAAGTGGCACATTCTGG + Intronic
1040923751 8:52653616-52653638 GGTGCTCATGTGACAGAGTTTGG + Intronic
1044986988 8:97764539-97764561 ACTGCTCAGGTCACACATCCAGG - Intergenic
1045439653 8:102197054-102197076 GGACCTCATGTGACCCATTCTGG + Intergenic
1047424399 8:124731949-124731971 CCTGCCCCAGTGACACATTCTGG + Intergenic
1048251907 8:132873294-132873316 GCTGCACATATGACACATGGAGG - Intronic
1049013721 8:139905460-139905482 CCTGCTCCTGTGGCACACTCGGG - Intronic
1053062633 9:35043953-35043975 GATGCTGGTGGGACACATTCAGG - Exonic
1055709760 9:79047976-79047998 GCTGTTCATGAGACACAGTCTGG - Intergenic
1056795066 9:89653158-89653180 GCTTCTCATGTGATAAATTATGG + Intergenic
1057400569 9:94719730-94719752 GGTGGTCCTGTGACACAGTCTGG - Intergenic
1059539223 9:115114114-115114136 GCTGGTCATGTCACACTTTGAGG + Intronic
1198505853 X:137300748-137300770 GCTACTCATGTGACCCCTGCTGG - Intergenic
1200163606 X:154021203-154021225 GCTCCTCCTGTGTCTCATTCTGG - Intergenic