ID: 1090081656

View in Genome Browser
Species Human (GRCh38)
Location 11:123617629-123617651
Sequence GACAGTAATACCTATCCTAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 135}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090081656_1090081659 -3 Left 1090081656 11:123617629-123617651 CCAGTAGGATAGGTATTACTGTC 0: 1
1: 0
2: 1
3: 14
4: 135
Right 1090081659 11:123617649-123617671 GTCCCTAGGTTGGAGAAGCTAGG 0: 1
1: 0
2: 1
3: 14
4: 216

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090081656 Original CRISPR GACAGTAATACCTATCCTAC TGG (reversed) Intronic
903874687 1:26465582-26465604 TACAGTAATACCTACCTTGCAGG + Intronic
906503510 1:46359817-46359839 GACTGTAATAACTTTCCTATTGG + Intronic
907122338 1:52018482-52018504 GTTACTAATACCTATCCCACAGG + Intergenic
907591091 1:55672132-55672154 GATAGTGATACCTATGCTACAGG - Intergenic
907671291 1:56477118-56477140 GACAGTAATACCTACAACACAGG + Intergenic
907725515 1:57016873-57016895 GATAATAATACCTACCCTGCCGG - Intronic
908311203 1:62886252-62886274 TATAGTAATACCTATCATATAGG + Intergenic
908837119 1:68239228-68239250 TACAATAGTACCTATCTTACAGG - Intergenic
909981793 1:82111574-82111596 GACAGTAAGACCTATTTTAATGG - Intergenic
910029610 1:82702806-82702828 GACAGTAACACAGATCTTACAGG + Intergenic
910700993 1:90073955-90073977 AACAGTAGTACCTATCTCACAGG + Intergenic
911575977 1:99578918-99578940 AACAAAAATACTTATCCTACTGG - Intergenic
912363964 1:109117612-109117634 GATGGTAATACCTATCTCACAGG + Intronic
912555575 1:110513810-110513832 GACAGTGACACCTACCCCACTGG + Intergenic
914463074 1:147902673-147902695 GACAGTAAAACCTACCCATCAGG + Intergenic
921503248 1:215933129-215933151 TATAGTAATACCTTTTCTACAGG - Intronic
923458458 1:234186787-234186809 GTCAATAATACCTACCCTGCAGG - Intronic
924010593 1:239660983-239661005 AACAGTAATATCTATCTCACTGG - Intronic
1064769425 10:18708825-18708847 AACAGTATTAACTAACCTACAGG + Intergenic
1065065109 10:21954789-21954811 AATAGTAGTACCTATCTTACAGG - Intronic
1069990712 10:72314154-72314176 GACAGTATTACCTGTGCTATGGG + Intergenic
1071715713 10:88093319-88093341 GACAAGAATACCTACCTTACTGG + Intergenic
1072475760 10:95758325-95758347 AACAGTAACATCTATCTTACAGG + Intronic
1074945514 10:118277265-118277287 GATAGTAATACCTACCTCACAGG + Intergenic
1078101112 11:8330873-8330895 GACAGTAATTCCTACCCTGCAGG + Intergenic
1080167996 11:29263282-29263304 GATAGTAGTACCAATCCCACGGG + Intergenic
1080322901 11:31035266-31035288 GACAGTATTAGCTAAACTACAGG + Intronic
1080389463 11:31831236-31831258 GAAAATAATACCTATTTTACAGG - Intronic
1082740330 11:56904020-56904042 GACACTAATACCTAACTCACGGG - Intergenic
1084077799 11:66795167-66795189 GATTGTAATACCTACCTTACAGG + Intronic
1085558923 11:77452005-77452027 GACAATAATAGCTCTCTTACAGG - Intronic
1085563697 11:77493738-77493760 GAGAGTAATACCTATTTTATAGG - Intergenic
1085932473 11:81100700-81100722 AGAAGTAATACCTACCCTACAGG - Intergenic
1086570362 11:88276739-88276761 GATAATAATACCTATCCAATAGG + Intergenic
1089141529 11:116288620-116288642 GATACTAATACCTATGCTACGGG + Intergenic
1090028323 11:123186187-123186209 GACAATAATACCAATCTCACAGG + Intronic
1090081656 11:123617629-123617651 GACAGTAATACCTATCCTACTGG - Intronic
1091145667 11:133277840-133277862 GACAATAATGCCTATCTTATGGG - Intronic
1091263343 11:134251475-134251497 GACAAGAATACCTACCTTACAGG + Intronic
1092009185 12:5095331-5095353 GACAGAAATACCTATCTCCCAGG + Intergenic
1094208759 12:27868373-27868395 GCCAGAAATAGCTTTCCTACAGG - Intergenic
1094357001 12:29588585-29588607 GACAGTAATCCTTATCCTTGTGG + Intronic
1095888062 12:47209225-47209247 GACAGTAAGAGCTACCCTGCAGG + Intronic
1095946238 12:47755278-47755300 GACATTAGTACCTATCTCACAGG + Intronic
1096202818 12:49697770-49697792 GAGGATAATACCTATCCTACAGG - Intronic
1098311225 12:69151124-69151146 GAGAGTAATACCTACCTTAGAGG + Intergenic
1099428750 12:82555067-82555089 CACAGCAATACATCTCCTACTGG + Intergenic
1102793264 12:115665964-115665986 GACAATAATAACTACCATACAGG + Intergenic
1106435015 13:29715593-29715615 GACAATAATAACTATCTCACAGG + Intergenic
1108031394 13:46233468-46233490 GTCAGTAATTCTTATGCTACTGG - Intronic
1108593742 13:51933330-51933352 GACAGTAATAGCTACCCTGCTGG + Exonic
1110225959 13:73119875-73119897 GAAAGTAATACCTGCCCTACAGG + Intergenic
1112043531 13:95572472-95572494 GATAGTAATACCTATCTCCCAGG + Intronic
1116591351 14:46779524-46779546 GACATTACTACACATCCTACAGG + Intergenic
1117100148 14:52337479-52337501 GCCAGTGATAGCTATCTTACTGG + Intergenic
1118136069 14:63029366-63029388 GACAGTAATACCCACCATTCTGG + Intronic
1119052416 14:71383202-71383224 GACAATAATACCTATCTCATAGG - Intronic
1121591560 14:95116950-95116972 GACAGTTATATCTATCAGACTGG + Intronic
1121619952 14:95339370-95339392 GACAGTAGTACCTACCTTGCAGG - Intergenic
1126532192 15:49723240-49723262 CACAGTAATAGCTATGTTACAGG + Intergenic
1126679898 15:51192704-51192726 GACAGTAATACCAACCTGACTGG + Intergenic
1131066440 15:89437607-89437629 AACAGTAACACCTATTCTAAAGG - Intergenic
1131693467 15:94851179-94851201 GTCAGTAATAAAAATCCTACCGG - Intergenic
1133659830 16:7905472-7905494 GACAATAAAACCTATTTTACAGG - Intergenic
1134391275 16:13822523-13822545 GACAATAGTACCTATCCCATAGG - Intergenic
1137995530 16:53206619-53206641 AACAGTAGTACCTATCTTACAGG + Intronic
1140132800 16:72178861-72178883 AACAATAATACCTACCTTACAGG + Intergenic
1143634216 17:8155146-8155168 GATAATAATACCTATCTCACGGG - Intronic
1146889759 17:36498897-36498919 CACAGTAACACCTACCCTGCAGG - Intronic
1156832969 18:41517087-41517109 GACAATAAGACCTATTCTACAGG - Intergenic
925035493 2:682132-682154 TAGAGTAACACCTCTCCTACAGG - Intergenic
927503540 2:23598222-23598244 GATAATAATACCTGCCCTACAGG - Intronic
930760576 2:55031020-55031042 AACAGTAGTACCTACCTTACAGG - Intronic
934899049 2:98142448-98142470 AACCGTAATACCTCTCCTAGGGG + Intronic
937395076 2:121528131-121528153 GACAGTTATACCTCTCTTTCAGG - Intronic
941317939 2:164018124-164018146 GACAGTAATACCTGTCTCATAGG - Intergenic
941513526 2:166443408-166443430 TACAGTAATACCTATCCCATTGG - Intronic
943293334 2:186104230-186104252 GAAAGTAATACCTATTTTATGGG + Intergenic
943979388 2:194528426-194528448 AACAGTAATACCTATACTGTAGG + Intergenic
946097132 2:217284544-217284566 GACAGTAATTCCTTTCAAACTGG - Intronic
946888898 2:224253424-224253446 CACAGTAGTAACTATCATACTGG - Intergenic
1171773363 20:29344384-29344406 GACAATAATACCTGTCACACAGG + Intergenic
1172260509 20:33560432-33560454 GACAATAATACCTACCTTATAGG + Intronic
1173848758 20:46204433-46204455 GATAGTAATACCTACCTCACAGG + Intronic
1177271594 21:18855637-18855659 TACAGTAATTCATATTCTACTGG + Intergenic
1177884882 21:26735173-26735195 GACAATAGCACCTATCCTCCAGG - Intergenic
951801916 3:26605423-26605445 GGGAATAATACCTATTCTACAGG - Intergenic
952527931 3:34232072-34232094 GACAGTAATGCCTATCAGATTGG - Intergenic
953159370 3:40404246-40404268 AATAGTTATACCTACCCTACAGG + Intronic
955270103 3:57489112-57489134 GACAGTAATACCTACTTTTCAGG - Intronic
956663825 3:71623864-71623886 GCCAGTCATACCTATTCTCCAGG + Intergenic
959820081 3:110723262-110723284 GACTTTAAAACCTATCCTACAGG + Intergenic
964680473 3:159332285-159332307 GCCAGTAATACCTACCTTATAGG - Intronic
971531939 4:27699849-27699871 AATAGTAATAACTATCCCACAGG + Intergenic
972272942 4:37529895-37529917 GATAATAATACCTATCTTATAGG - Intronic
975735031 4:77372730-77372752 GATAGTAATTCCCCTCCTACTGG + Intronic
977900504 4:102416904-102416926 GACAGTAACACCTAACTTAAAGG - Intronic
978624671 4:110671259-110671281 AACATTAATACCTATCTTATAGG + Intergenic
981065027 4:140474294-140474316 GACAGTAATAGCTACCTCACAGG + Intronic
981586099 4:146303852-146303874 GACAATAATATCTATCGTAAAGG - Intronic
983397045 4:167212069-167212091 GACAATAATACCTACAATACAGG + Intronic
983869875 4:172812792-172812814 GACAATAATAGTTACCCTACAGG + Intronic
984735287 4:183102440-183102462 GACAGTAGTACCTACCTCACAGG - Intronic
984954344 4:185030813-185030835 GACAGTTGTGCCTATCCCACTGG + Intergenic
991019376 5:61964092-61964114 CACAGTCATACCTAGCCTACAGG - Intergenic
997825444 5:137102773-137102795 GACAATAGTACCTACCTTACAGG + Intronic
998971734 5:147599863-147599885 AAAAGCAATACCTATCCCACAGG + Intronic
1000204331 5:159043550-159043572 GACAGTGATACCAATTCTCCTGG - Intronic
1001171717 5:169425555-169425577 GATAGTAATATCTATCTTATAGG + Intergenic
1001375761 5:171256284-171256306 GGGAGTAATACCTACCTTACAGG + Intronic
1001555391 5:172633529-172633551 GACAGTAATATCTACCTCACAGG - Intergenic
1001786097 5:174414834-174414856 GACTGAAATACCTAGCCCACAGG + Intergenic
1002489360 5:179563387-179563409 GACACTAACAGCTATCCTAGAGG - Intronic
1010364151 6:75030501-75030523 GACAATAATACCTGTTTTACTGG - Intergenic
1011436662 6:87345469-87345491 TATACTAATACCTATCTTACAGG + Intronic
1014066843 6:117137020-117137042 CACAGTCATAGCTAACCTACAGG + Intergenic
1015483085 6:133736630-133736652 ATCAATAATACCTATGCTACAGG + Intergenic
1015706338 6:136092054-136092076 GACAGTAATTTTTATGCTACAGG - Intronic
1016052905 6:139549026-139549048 GATAATGATACCCATCCTACAGG - Intergenic
1017918977 6:158855181-158855203 CATAGTTATACCAATCCTACAGG + Intergenic
1024333831 7:48183453-48183475 CACAGTATTACCTATCTCACTGG + Intronic
1024697914 7:51875197-51875219 TACAGTAAGACTTATGCTACAGG - Intergenic
1027414491 7:77960569-77960591 AACAGTAATACCTATCTTACAGG + Intergenic
1027450344 7:78324510-78324532 AATAATTATACCTATCCTACAGG + Intronic
1027456739 7:78401790-78401812 GACAATAATACCTACCACACAGG + Intronic
1027827069 7:83129192-83129214 TACAATAAAACCTATCCCACAGG + Intronic
1028223523 7:88223299-88223321 GACAATAGTACCTATCCCATGGG - Intronic
1029009920 7:97248960-97248982 GATAGTAATACCTGCCATACTGG + Intergenic
1030248432 7:107412150-107412172 AACAATAATACCAATCTTACTGG + Intronic
1030279520 7:107757940-107757962 GACAGAAATGCCTATCTTAATGG + Intronic
1032305938 7:130733046-130733068 GACAGCAATGACTGTCCTACAGG + Exonic
1036515394 8:9439006-9439028 AAAAATAATACCTATCTTACAGG - Intergenic
1039064311 8:33595930-33595952 GAGAGTGATACCTATCTCACAGG + Intronic
1039483164 8:37890548-37890570 GACAGAAATTCCTCTCCTGCAGG - Intronic
1041017145 8:53602035-53602057 GGCAATAATACTTATTCTACAGG - Intergenic
1041797132 8:61757173-61757195 GATAGTAATAGCTACCCCACAGG + Intergenic
1044889952 8:96824302-96824324 GGCAGTAATACCTATCATATAGG + Intronic
1047170738 8:122490139-122490161 GACAGTGATACTTATCTCACTGG - Intergenic
1049050823 8:140193811-140193833 GACTGTAATACCTATCTTTCAGG + Intronic
1051131593 9:13867222-13867244 GATAGTAGTACCTATCTCACAGG - Intergenic
1052398101 9:27965993-27966015 AACAATATTAACTATCCTACAGG + Intronic
1060565890 9:124591308-124591330 GATAGTAATACCTATCTCACAGG - Intronic
1186182599 X:6987478-6987500 GGCAGTAATACCTACCTTGCAGG + Intergenic
1188418722 X:29971026-29971048 GACAGTAATACCTTTCATGAAGG + Intergenic
1189650244 X:43181198-43181220 AACAATAATGACTATCCTACTGG - Intergenic
1191055934 X:56240864-56240886 AACAGTAATACCTACCTCACAGG + Intronic
1193517106 X:82479157-82479179 GACACTAATACCTAACTCACAGG + Intergenic
1197014367 X:121605790-121605812 GAGAGTAATACCTAACTAACAGG - Intergenic
1197613270 X:128662742-128662764 AACAGTTATACCTGTCCTCCAGG - Intergenic
1197838292 X:130718480-130718502 AACAGTAATACTGATCTTACAGG + Intronic
1199589064 X:149449112-149449134 GAAAGAAATACATAACCTACTGG - Intergenic