ID: 1090085667

View in Genome Browser
Species Human (GRCh38)
Location 11:123648765-123648787
Sequence CATGACAAACACACTCCTTT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 194
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 177}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090085667_1090085669 6 Left 1090085667 11:123648765-123648787 CCCAAAGGAGTGTGTTTGTCATG 0: 1
1: 0
2: 1
3: 15
4: 177
Right 1090085669 11:123648794-123648816 AGACAGCAAACAGTCCAATGTGG 0: 1
1: 1
2: 1
3: 12
4: 212

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090085667 Original CRISPR CATGACAAACACACTCCTTT GGG (reversed) Intronic
900034299 1:394123-394145 CATCACACACACACTGCCTTTGG + Intergenic
901596177 1:10386973-10386995 CATCACAAGCATACTCCTCTGGG + Intergenic
901815589 1:11791636-11791658 CAAGCCAAACACACTCCTGGAGG - Intronic
903198621 1:21713714-21713736 CTGGAAAAATACACTCCTTTTGG + Intronic
904285920 1:29453247-29453269 CATGACCACCACACTCCTGGAGG + Intergenic
904767059 1:32858052-32858074 CATGCCAAACATCCACCTTTGGG + Exonic
906137740 1:43511522-43511544 CATGTCACACACCCACCTTTGGG - Intergenic
910026160 1:82656644-82656666 GATGAAAAACACATTACTTTTGG + Intergenic
911621607 1:100072001-100072023 CATGACACACACAGTCCATGAGG + Intronic
912027660 1:105198936-105198958 CAACACAAACCCACCCCTTTGGG + Intergenic
915680186 1:157573945-157573967 CAAGACCCACACATTCCTTTTGG + Exonic
917541893 1:175922504-175922526 CATGACAAACACCTCCCATTAGG + Intergenic
917980014 1:180263374-180263396 CATCACAGACACACCCCTGTAGG + Intronic
921073476 1:211681726-211681748 CATGGCAAACAAACTCCCTGGGG - Intergenic
922256654 1:223898320-223898342 CATCACACACACACTGCCTTTGG + Intergenic
922688090 1:227663744-227663766 CATGAAAGCCAGACTCCTTTGGG + Intronic
923928105 1:238659044-238659066 ACTGACAAACACACTCCTTATGG - Intergenic
924337859 1:243001173-243001195 CATCACACACACACTGCCTTTGG + Intergenic
1064223830 10:13464835-13464857 CCTTACACACACACTCTTTTGGG + Intronic
1065290215 10:24222330-24222352 CATTAAAAACTCTCTCCTTTTGG - Intronic
1066458531 10:35593517-35593539 CATTACACACACACGCCTGTGGG - Intergenic
1066470121 10:35689799-35689821 CATTAGAAACCCATTCCTTTGGG + Intergenic
1068723276 10:60271727-60271749 TCTGGCAAACACACTGCTTTTGG + Intronic
1070371512 10:75786831-75786853 CATAGCACACACACTACTTTTGG + Intronic
1072032875 10:91538144-91538166 CATGACAAGCACGCTGCTGTGGG + Intergenic
1074894818 10:117766213-117766235 CAAGACAAACACAATCTGTTTGG - Intergenic
1075864507 10:125706034-125706056 CATGACAAACACACTGGGCTGGG - Intergenic
1076311153 10:129508396-129508418 ACTGACAAACACACTGTTTTAGG - Intronic
1076893151 10:133294930-133294952 CAAGCCACACCCACTCCTTTAGG - Intronic
1078754745 11:14198636-14198658 CATGACAATCCCACTCATTCAGG + Intronic
1083626276 11:64073715-64073737 CCTCCCAAACACACTCCTTGGGG + Intronic
1085456764 11:76670080-76670102 CATCACAGCCACATTCCTTTGGG - Intronic
1085765612 11:79279288-79279310 GATGAGTAACACAGTCCTTTGGG + Intronic
1090085667 11:123648765-123648787 CATGACAAACACACTCCTTTGGG - Intronic
1092132948 12:6125101-6125123 CCTGACAAAAACAGTCCATTTGG + Intergenic
1096448537 12:51717139-51717161 CATGGCAAGCCCACTCCTCTTGG + Intronic
1099382096 12:81967669-81967691 AATGCCAAACATAGTCCTTTTGG + Intergenic
1101700343 12:107168170-107168192 TAGGACAAAAATACTCCTTTTGG - Intergenic
1104125588 12:125842596-125842618 CATGACAAGGACAATGCTTTAGG - Intergenic
1105588521 13:21767880-21767902 CATGACAACCATAGCCCTTTAGG - Intergenic
1106825640 13:33517641-33517663 CAAGACAAACACAATCAGTTTGG - Intergenic
1106942459 13:34793398-34793420 CATGACAAACTCAGTCCTCCAGG - Intergenic
1107653374 13:42567499-42567521 CATTAGAAATGCACTCCTTTAGG + Intronic
1107761065 13:43679390-43679412 CATGACACACACACACGTTTTGG + Intronic
1107922367 13:45222315-45222337 CAATACAAACAAAATCCTTTGGG + Intronic
1108804738 13:54140563-54140585 CATAACAAACACACTCCTTGTGG + Intergenic
1111048997 13:82854248-82854270 AATGACTAATACATTCCTTTTGG + Intergenic
1112784581 13:102938043-102938065 CATGAGAGACACACTGCTGTAGG + Intergenic
1113300056 13:109009299-109009321 CATCACTAAAACTCTCCTTTTGG + Intronic
1113559774 13:111269471-111269493 CCTGACAAACACACTCATTAAGG - Intronic
1115952712 14:38739195-38739217 CATGAAAACCAAACTCTTTTTGG + Intergenic
1116700846 14:48239562-48239584 CATGATAATCACATTTCTTTTGG - Intergenic
1117379654 14:55148397-55148419 CATGCCAGACACATTTCTTTTGG - Exonic
1118729207 14:68654889-68654911 CAAGACAATCCCACTCCATTTGG + Intronic
1121810315 14:96881435-96881457 CATCACAAACACACGGCTTTGGG - Exonic
1124447058 15:29745643-29745665 CAACACAAACACACTCTTTAAGG + Intronic
1125863819 15:43023859-43023881 TATGACAAATACGCTCCCTTAGG + Intronic
1127335796 15:57982146-57982168 AATAACAAACACACTCTTTCTGG + Intronic
1127735256 15:61833472-61833494 CATGGCTCACACACTCCTTCAGG + Intergenic
1127853899 15:62939187-62939209 TATGTCAAACACATTGCTTTAGG + Intergenic
1128559561 15:68655715-68655737 TATTACCAACACATTCCTTTGGG - Intronic
1130984400 15:88835314-88835336 CCTGACTAACACAGTCCTTCAGG - Intronic
1131755909 15:95561829-95561851 AAACACAAACACACACCTTTTGG + Intergenic
1131973477 15:97916816-97916838 TATGATAAACACTGTCCTTTTGG + Intergenic
1132228680 15:100165206-100165228 CTTGACAAAGACAGTCCTTAGGG + Intronic
1136750452 16:32630878-32630900 CATCAAAAACACACTTCTTTTGG + Intergenic
1137550869 16:49436722-49436744 CTCCACACACACACTCCTTTGGG + Intergenic
1139008066 16:62598099-62598121 CAAGACAAACAGACTTCATTAGG - Intergenic
1140106376 16:71964258-71964280 CATGACAAACACAGACCCTTGGG - Intronic
1140902391 16:79381389-79381411 CATCACAAACACACTTATCTGGG - Intergenic
1203052582 16_KI270728v1_random:890082-890104 CATCAAAAACACACTTCTTTTGG + Intergenic
1144281988 17:13735572-13735594 CATGACAAACACACTGTGTGAGG + Intergenic
1145234525 17:21199386-21199408 CATGACAAACACAGGCCTGGTGG + Intronic
1147157185 17:38549873-38549895 CATGCCACACACACACCTTCAGG + Intronic
1153651887 18:7248222-7248244 CAAAACAAACATACTCCTCTAGG + Intergenic
1153903163 18:9636941-9636963 CAAGACAAGTACACTCCTTTAGG + Intergenic
1154419850 18:14218528-14218550 CAAAACAAACACACTGCTATAGG - Intergenic
1157065447 18:44343787-44343809 CAAGATAACCACACTCATTTTGG - Intergenic
1157428367 18:47602844-47602866 CAAGACAAACACAGTCTTTGGGG + Intergenic
1158190948 18:54828309-54828331 AGTGAGAAACACACTCCTCTCGG - Exonic
1158949511 18:62480152-62480174 CCAGACAAACACAATTCTTTAGG - Intergenic
1164803796 19:31100311-31100333 TAAGAGAAACAAACTCCTTTGGG + Intergenic
926229700 2:10993071-10993093 CCTGACAACCTCCCTCCTTTGGG + Intergenic
930296038 2:49555107-49555129 ATTGACAAACACTTTCCTTTCGG - Intergenic
930521071 2:52468256-52468278 CATGGCAATCACATTCCTTCTGG + Intergenic
931575406 2:63713238-63713260 CATTCCATACACACCCCTTTGGG + Intronic
933512349 2:83257023-83257045 CAGGACAAACACAGTCCTCCTGG - Intergenic
936039712 2:109140992-109141014 CCTGACAACCAGACTCCTGTTGG + Intronic
936968683 2:118152879-118152901 CATGACAAAAAAATTCCTGTTGG - Intergenic
937099680 2:119259315-119259337 CATGACAATCCCTCTCCTTTTGG + Intronic
939554603 2:143659473-143659495 CATGAAAGACACACTCTTCTTGG - Intronic
940133038 2:150405969-150405991 CATGAAAAAAAAAATCCTTTGGG - Intergenic
940198005 2:151117389-151117411 CATGATAAACACTTTCCATTAGG - Intergenic
942753334 2:179312881-179312903 CAGGGCAAAGAAACTCCTTTTGG - Intergenic
943631076 2:190253235-190253257 AATTACCAGCACACTCCTTTGGG + Intronic
944822196 2:203441981-203442003 CTTGACACACACACTCGTGTTGG + Exonic
947196928 2:227577394-227577416 CATGACAAAAACATTCCATCTGG - Intergenic
948094274 2:235321242-235321264 CATGAAAAGCAAACTCCTCTAGG + Intergenic
1170145192 20:13165842-13165864 CAAGACCAACACACTTGTTTAGG + Exonic
1173308993 20:41879388-41879410 AAGAACAAACACACTGCTTTAGG + Intergenic
1174211782 20:48885262-48885284 TATGCCACACACACTCTTTTAGG - Intergenic
1176853446 21:13940783-13940805 CAAAACAAACACACTGCTATAGG + Intergenic
1178352760 21:31884620-31884642 AAGGACAAACAAGCTCCTTTAGG - Intronic
1182057911 22:27374683-27374705 CATCACAAAGATACTCCTTGAGG + Intergenic
950615398 3:14153936-14153958 CATGACATAATCACTCCTCTGGG - Intronic
953700019 3:45188185-45188207 CCTGGCAAACACAGTCCTTGAGG - Intergenic
953764253 3:45723108-45723130 CATGCCACCCACACACCTTTTGG - Intronic
953985648 3:47440529-47440551 CATGACAAAGATACTCATTTGGG + Intronic
956024481 3:64968159-64968181 CATCACAAACAAACTCCAATGGG - Intergenic
961399564 3:126627455-126627477 CATGTAATCCACACTCCTTTAGG - Intronic
964492394 3:157250715-157250737 AAGGACAAACAAGCTCCTTTTGG + Intergenic
965364774 3:167784836-167784858 CATGATAAAAATACTCATTTTGG + Intronic
965427263 3:168542521-168542543 CACCACAAACACACTTATTTAGG + Intergenic
966505223 3:180693079-180693101 CCTAACAACCACACTCCTTAAGG + Intronic
967124596 3:186412556-186412578 CATGGCATACACCCTCCTTTTGG + Intergenic
969978841 4:11133124-11133146 CATAACAAACACTCTCATTTGGG + Intergenic
972487678 4:39557763-39557785 CAGAAAAAACACTCTCCTTTGGG + Intronic
974107872 4:57491186-57491208 CATGACAAACATACACCTCAGGG + Intergenic
975615917 4:76246815-76246837 CATTAAAAACATACTTCTTTTGG + Intronic
976533287 4:86181270-86181292 TATGACACAAAAACTCCTTTTGG - Intronic
979216606 4:118171787-118171809 TGTGGCAAACCCACTCCTTTTGG - Intronic
979239278 4:118434159-118434181 CATCACACACACACTGCCTTTGG - Intergenic
981067410 4:140499291-140499313 CAACAGAAACACAATCCTTTAGG - Intergenic
981775663 4:148364303-148364325 CCTGACTGACACACTGCTTTAGG + Intronic
981964707 4:150585589-150585611 CAAGACAAACCAATTCCTTTGGG - Intronic
982298099 4:153850678-153850700 CAGCACAATCACCCTCCTTTGGG - Intergenic
985996140 5:3598058-3598080 CTGGAGAAACACACACCTTTTGG - Intronic
989766463 5:45090454-45090476 TATGAAAAACAAGCTCCTTTAGG - Intergenic
990013637 5:51030748-51030770 CAGGAAAAACTCTCTCCTTTTGG - Intergenic
990411505 5:55545745-55545767 CATGGCAAACACACAACTTCTGG + Intergenic
992602376 5:78415271-78415293 TATGACAAACACTCTCCTCCAGG - Intronic
992903390 5:81321322-81321344 AAGGACAAACAAACTCCTTCAGG + Intergenic
992942043 5:81772130-81772152 CACCTCAAACACACTCCTCTGGG - Intergenic
993061240 5:83041627-83041649 TATACCAAACACACTCCCTTTGG - Intergenic
997369568 5:133349749-133349771 CATGACAAAGTCCATCCTTTGGG - Intronic
998094243 5:139388360-139388382 CACAACACACACACTCCTCTAGG - Intronic
999442679 5:151614846-151614868 CTTGGCAAACAAACACCTTTCGG + Intergenic
1001128831 5:169046622-169046644 CACCAAAAACACATTCCTTTTGG + Intronic
1002739521 5:181424745-181424767 CATCACACACACACTGCCTTTGG - Intergenic
1010162060 6:72868263-72868285 CATAACACACACAGTGCTTTTGG - Intronic
1011599920 6:89050447-89050469 CAGGACAAACATACTCCCTCAGG - Intergenic
1011905576 6:92363153-92363175 GAACACAAACACAATCCTTTAGG + Intergenic
1012233580 6:96787506-96787528 AATGAGAAACACATTACTTTAGG + Intergenic
1015065451 6:129020720-129020742 CATGACAATTACATTCCTTCTGG + Intronic
1017064552 6:150517415-150517437 TATGACAAACACATTTCTGTTGG + Intergenic
1018007676 6:159638484-159638506 CATGACAATGGCACTCCTTCTGG - Intergenic
1021122351 7:16810760-16810782 GATGATAAATACACTCCTTCGGG + Intronic
1025762959 7:64411857-64411879 CATGACAAATAAAATCTTTTTGG + Intergenic
1026289814 7:68996470-68996492 CAAGACAGACACACTCTATTAGG - Intergenic
1028094998 7:86749230-86749252 CATGTGAAACACCATCCTTTGGG + Intronic
1030617432 7:111752907-111752929 CAGGACAAAAACACTTTTTTTGG + Intronic
1032065932 7:128770702-128770724 CAACACAAACACTGTCCTTTTGG + Exonic
1032591649 7:133197487-133197509 GATGAAAAACCCACTCCTATAGG + Intergenic
1034076310 7:148234804-148234826 CATGACAATCACACATTTTTGGG + Intronic
1035466578 7:159083433-159083455 CTTGACCAACACACTCATCTAGG - Intronic
1035503489 8:107860-107882 CATCACACACACACTGCCTTTGG + Intergenic
1035932056 8:3791132-3791154 CATGACAAACATATTCTTCTAGG + Intronic
1036441380 8:8784081-8784103 AATGACAAAAATGCTCCTTTGGG - Exonic
1038040419 8:23719564-23719586 TATGACAAACAAACCCTTTTGGG + Intergenic
1038825639 8:30997371-30997393 CATGACATTAACACACCTTTGGG + Intronic
1039761893 8:40585529-40585551 CATAAAAATCATACTCCTTTTGG + Intronic
1040346499 8:46504533-46504555 CATGTCAGACACACTGTTTTTGG - Intergenic
1041256623 8:55984348-55984370 CATGCCCAACACACATCTTTGGG - Intronic
1044003980 8:86919232-86919254 AGTGGCATACACACTCCTTTTGG + Intronic
1044344944 8:91094551-91094573 CATCTTAAACACACTCCTTATGG - Intergenic
1044593721 8:93938826-93938848 CATGACCAACAGATTCATTTGGG + Intergenic
1045048709 8:98303319-98303341 CATGACTGATATACTCCTTTGGG - Intergenic
1045801771 8:106110340-106110362 GATGACATACACCCTCCTTTGGG - Intergenic
1046887556 8:119384310-119384332 CATGACCACCACAGTCATTTGGG + Intergenic
1047563585 8:126015560-126015582 CATGACTATAACACTCCTTTGGG + Intergenic
1049114867 8:140677291-140677313 CCTGACACACACAGTGCTTTGGG - Intronic
1051583183 9:18699225-18699247 CATGACAATGACGCTCTTTTGGG - Intronic
1052098901 9:24419204-24419226 TAAGACAAAAACACTACTTTAGG + Intergenic
1055200867 9:73660273-73660295 TATGAAAAACACACTAATTTTGG - Intergenic
1055523990 9:77111405-77111427 TAAGACAACTACACTCCTTTTGG - Intergenic
1056520204 9:87394032-87394054 GAAGACAAACACACTGATTTTGG + Intergenic
1059034540 9:110739784-110739806 CATGTCCAACCCAGTCCTTTGGG + Intronic
1059819228 9:117953426-117953448 CATAACATACAAACTCCTTATGG - Intergenic
1061329708 9:129884958-129884980 CAGAAGAAACACACGCCTTTGGG + Intergenic
1203604827 Un_KI270748v1:49546-49568 CATCACACACACACTGCCTTTGG - Intergenic
1186412903 X:9359532-9359554 CATGACAAAGACACAGTTTTAGG - Intergenic
1186528162 X:10268572-10268594 CATAACACCCACCCTCCTTTGGG - Intergenic
1188969063 X:36590768-36590790 CATCAGCAGCACACTCCTTTTGG - Intergenic
1189258960 X:39663783-39663805 CATGACAGACAAACCCCTCTGGG + Intergenic
1190417600 X:50196402-50196424 TGTGACATACAAACTCCTTTTGG - Intronic
1192325635 X:70129593-70129615 CATGACAATTACATTCCTTTTGG + Intergenic
1196101272 X:111849653-111849675 CAAGCCAAACTCAGTCCTTTGGG + Intronic
1196592668 X:117505407-117505429 CATTAAAAATTCACTCCTTTGGG + Intergenic
1196592817 X:117507370-117507392 CATTAAAAATTCACTCCTTTGGG + Intergenic
1197891278 X:131272998-131273020 CATTACACGCACATTCCTTTGGG + Intergenic
1198219342 X:134585615-134585637 CATCATAAACACACTCCCTGGGG - Intronic
1199288001 X:146075286-146075308 CATGACAAACAGATTTGTTTGGG + Intergenic
1199696529 X:150346493-150346515 CCTGACCATCACACTCATTTTGG - Intergenic
1201680314 Y:16638437-16638459 CTATACAAACACATTCCTTTTGG + Intergenic