ID: 1090086301

View in Genome Browser
Species Human (GRCh38)
Location 11:123654042-123654064
Sequence CGGCGAGAGCGGGCGCGGAG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 286
Summary {0: 1, 1: 1, 2: 0, 3: 33, 4: 251}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090086301_1090086309 18 Left 1090086301 11:123654042-123654064 CCGCTCCGCGCCCGCTCTCGCCG 0: 1
1: 1
2: 0
3: 33
4: 251
Right 1090086309 11:123654083-123654105 AGTCGCCTCCCCGCCCACCCCGG 0: 1
1: 0
2: 0
3: 21
4: 228
1090086301_1090086306 -7 Left 1090086301 11:123654042-123654064 CCGCTCCGCGCCCGCTCTCGCCG 0: 1
1: 1
2: 0
3: 33
4: 251
Right 1090086306 11:123654058-123654080 CTCGCCGGCGCTCAGCACCACGG 0: 1
1: 0
2: 0
3: 7
4: 78

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090086301 Original CRISPR CGGCGAGAGCGGGCGCGGAG CGG (reversed) Exonic
900206972 1:1435788-1435810 CGGCTGGCGCTGGCGCGGAGCGG + Exonic
900461787 1:2805273-2805295 CGGGGAGGGAGGGCGTGGAGTGG - Intergenic
901242864 1:7704952-7704974 CGGCGGGGGCGCGCGCGGGGCGG + Intronic
901433876 1:9234713-9234735 CGGCGGGGGCGGGGGCGGGGCGG - Intergenic
901433885 1:9234728-9234750 CGGCGGGGGCGCGCGCGGCGGGG - Intergenic
901641372 1:10694699-10694721 CGGCGCGGGCGCGCGCGGCGGGG - Intronic
903164196 1:21509440-21509462 CCAGGATAGCGGGCGCGGAGTGG - Exonic
903446151 1:23424164-23424186 CGGCGATGGCGGGGGCGGGGCGG - Intronic
904044867 1:27603147-27603169 CGGGGAGGGGGGGCGGGGAGGGG - Intronic
905584329 1:39105271-39105293 CGGGGAGAGGGGGCGGGGAACGG + Intronic
906264427 1:44417749-44417771 CTGGGGGAGGGGGCGCGGAGAGG + Intronic
910694333 1:89995457-89995479 CGCCGGCAGCGGGCGCCGAGCGG - Intronic
914702904 1:150150232-150150254 CAGCGGGCGCGGGCGCGGGGCGG - Exonic
914803153 1:150974738-150974760 GGGCGAGGGCGGGCGCGGGCCGG - Exonic
917490492 1:175494137-175494159 CGGCGGGAGGGGGCGGGGTGGGG - Intronic
920120239 1:203650644-203650666 GGGCGAGGGCGGGCGGGGAGCGG + Intronic
921029819 1:211327118-211327140 CGGGGACAGCGGGAGCGGTGCGG + Intronic
921930182 1:220748505-220748527 GAGCGAGGGCGGGCGCGGACCGG - Exonic
921979013 1:221234748-221234770 CTCCGAGAGGGGGCGGGGAGGGG + Intergenic
922119036 1:222644234-222644256 CGGCGAGGGCGGGGCCAGAGCGG - Intronic
922722765 1:227906933-227906955 GGGAGAGAGCGGGAGGGGAGAGG - Intergenic
924289663 1:242524526-242524548 GGGCGGGGGCGGGGGCGGAGGGG + Intronic
1064712325 10:18140425-18140447 CCGGGAGAGCGGGCGCAGCGCGG - Intergenic
1065099739 10:22321337-22321359 GGGGGAGGGCGCGCGCGGAGGGG - Exonic
1065660222 10:27998693-27998715 AGGCGAGAGCGGCAGCGGCGGGG + Intronic
1067525390 10:47035428-47035450 CGGCGAGAGCTGGGTTGGAGGGG + Intergenic
1071291860 10:84194619-84194641 CGGCGGGAGGGGGCACGGGGCGG - Intergenic
1072021838 10:91410290-91410312 GGGCGCGGGCGGGGGCGGAGTGG + Exonic
1072151846 10:92690229-92690251 CGGCCAGCGCGGCGGCGGAGTGG - Exonic
1073106032 10:101032423-101032445 CGGCGACAGCGGAGGCAGAGAGG + Exonic
1073196394 10:101695039-101695061 CGGCGAGGGCGAGGGCGGAGAGG - Exonic
1074377493 10:112951635-112951657 CGGCGCGGGCGGGCGGGCAGCGG - Intronic
1076792671 10:132785497-132785519 CGGGGCGGGTGGGCGCGGAGGGG - Intronic
1077491504 11:2862926-2862948 CGGCGGGCGCGGGCCCGGGGCGG + Intergenic
1078057533 11:8019664-8019686 CCCCGAGAAAGGGCGCGGAGGGG + Intronic
1078514119 11:12008585-12008607 CGGCGGCTGCGGGCGCAGAGCGG - Exonic
1080037363 11:27722893-27722915 AGGCGGGAGGGGGGGCGGAGGGG + Intergenic
1080551441 11:33376521-33376543 CGGAGGGAGGGGGCGCCGAGCGG - Intergenic
1081872919 11:46391471-46391493 GGGCGAGCGCGGGCCGGGAGCGG - Intergenic
1082005843 11:47418569-47418591 CGGGGAGAGAGGGCTCTGAGGGG + Intergenic
1082814594 11:57499695-57499717 CGGCCAGAGGGAGCGGGGAGAGG + Intronic
1083595574 11:63917079-63917101 CGGGGAGAGCGAGCGCGCCGGGG - Intergenic
1083872490 11:65497714-65497736 AGGGGAGAGCGGGGGCGGGGAGG - Intergenic
1083879455 11:65540827-65540849 CGGGGTGAGAGGGCGCGGGGCGG + Intronic
1084083199 11:66842753-66842775 CTGGGAGAACGGGCGCCGAGGGG - Intronic
1085037180 11:73307722-73307744 CGCAGAGGGCGGGCGGGGAGGGG + Intergenic
1087761734 11:102110336-102110358 CGGTGCGGGCGGGCGCGCAGAGG + Intergenic
1089525623 11:119094802-119094824 CGGCGAAGGCGGGCGAGGGGAGG + Exonic
1090086301 11:123654042-123654064 CGGCGAGAGCGGGCGCGGAGCGG - Exonic
1090697560 11:129263614-129263636 CGGGGAGAGGGGGAGGGGAGAGG + Intronic
1091616201 12:2052922-2052944 GGGCGGGCGCGGGCGCGGCGGGG + Intronic
1094841925 12:34345829-34345851 CGGCAGGGGCGGGCGTGGAGGGG + Intergenic
1096127681 12:49131497-49131519 CGGCCAGGCCGGGCGCGGAGTGG - Intergenic
1096396395 12:51269861-51269883 CGGCGAAAGCAGGCCCGGAGGGG - Intronic
1097079719 12:56421218-56421240 CCGAGAGAGCAGGCGCGGGGGGG - Intronic
1097234325 12:57529175-57529197 CGGCCAGGGCGGGCCCGGGGAGG - Exonic
1097872009 12:64610130-64610152 CGGAGAGGGCGGGAGCAGAGCGG - Intergenic
1101612122 12:106302304-106302326 CGGGGGGAGCGGGGGCTGAGCGG - Intronic
1102084374 12:110124242-110124264 CGGGGAGGACGGGCGCGGGGCGG - Intergenic
1104916215 12:132266077-132266099 CGGCGAGATCGGGCGTGTAAAGG - Intronic
1104957994 12:132475261-132475283 CGGGGAGAGAGGGGGCGGGGGGG - Intergenic
1106422498 13:29595497-29595519 CGGCGAGACCGGGCGGGGCGGGG + Exonic
1106602752 13:31200822-31200844 CCGCGGGAGCTGGCGCGGCGGGG + Intronic
1107467637 13:40665126-40665148 CGGCGGGGGAGGGCGCGGCGAGG - Intronic
1108542071 13:51453635-51453657 CGGCGCGAGCGGGCGCGGGCGGG + Intronic
1115911023 14:38256150-38256172 CGTCGGGAGCGAGGGCGGAGGGG - Exonic
1117156964 14:52951096-52951118 CGGACAGAGGGGGCGGGGAGAGG - Intronic
1117392042 14:55271607-55271629 CGGCGGTAGGGGGCGGGGAGCGG - Intronic
1117875980 14:60249871-60249893 CGGCGAGGGCGGTGGCGGGGAGG + Intronic
1119602056 14:75982810-75982832 CTGCGAGAGCGGCTCCGGAGCGG - Intronic
1121050492 14:90816453-90816475 CGGCGGCGGCGGGCGCGGCGGGG + Intronic
1121595304 14:95157543-95157565 CGGAGCGTGGGGGCGCGGAGGGG - Intronic
1121616982 14:95319908-95319930 CGGCGGGCGCGGGCGGGGCGCGG + Intergenic
1121617020 14:95319998-95320020 TGGCGCGAGCGAGCGCGGGGCGG + Intergenic
1121879435 14:97486912-97486934 GGGCGAGGCCGGGGGCGGAGTGG + Intergenic
1122543297 14:102509491-102509513 CGGCGGCCGCGGGCGCGGCGCGG + Intronic
1122938137 14:104969338-104969360 GGGCTAGAGCAGGCACGGAGAGG - Intronic
1123036556 14:105474217-105474239 GGGCGCGGGCGGGGGCGGAGCGG + Intronic
1125300737 15:38252159-38252181 AGGCCAGAGCGGGCGCGGGGTGG - Intergenic
1128582660 15:68820096-68820118 CGGGGAGAGCGCGTGGGGAGGGG - Intronic
1128654831 15:69453019-69453041 CGGTGAGTGCGGGCGCGGGCCGG + Exonic
1128743692 15:70099374-70099396 CGGCCGGAGCGGGCGCGGGGAGG - Intergenic
1128992535 15:72272655-72272677 CCGCGCGAGCGTGCGCAGAGTGG - Intronic
1129052844 15:72796990-72797012 CCGCGAGAGCGGCCGCGGCGCGG + Intergenic
1129644835 15:77420215-77420237 GGGCGAGGGCGCGCGCGGAGGGG - Intergenic
1131107572 15:89745223-89745245 AGGGGAGAGCGGGTGGGGAGAGG + Intergenic
1132314351 15:100879592-100879614 GGGCGAGAGAGCGCGCGGCGCGG + Exonic
1132544798 16:528105-528127 CGGGGAGCGCGGGCTCGGCGGGG + Intronic
1133052272 16:3124034-3124056 CGGTGAGGGCGGAGGCGGAGAGG + Intergenic
1134417751 16:14059362-14059384 CGGGGAGAGGGGGCAGGGAGAGG - Intergenic
1136913591 16:34162449-34162471 CGGCGGGGGCGGACGAGGAGGGG - Intergenic
1137738377 16:50742019-50742041 GGGAGGGAGCGGGGGCGGAGGGG - Intergenic
1139664509 16:68447085-68447107 CGGGGGGCGCGGCCGCGGAGGGG - Intronic
1141153651 16:81582045-81582067 CGAAGAGAGCTGGCGGGGAGAGG + Intronic
1141422216 16:83924755-83924777 CGGTGAGAGCTGGCAAGGAGAGG - Exonic
1141461584 16:84181274-84181296 CTGCGGGAGCGGCCGCAGAGCGG - Intronic
1142039127 16:87881358-87881380 AGGAGAGGGCGGGGGCGGAGGGG + Intergenic
1142434505 16:90047833-90047855 CGGTGAGAGGGGGCGGGGGGCGG + Intergenic
1142708399 17:1710282-1710304 CCGAGAGCGCGGGCGCCGAGGGG - Exonic
1143183490 17:4997904-4997926 ACGCGCGAGCGCGCGCGGAGGGG - Intergenic
1143390401 17:6556364-6556386 AGGTGAGGGCGGGCGCGGGGAGG - Exonic
1143554372 17:7651484-7651506 GGGCGAGTCCGGGCGCGGGGCGG - Exonic
1145286723 17:21511743-21511765 CGGCGCCAGCGGCCGCGGATCGG - Intergenic
1146110523 17:30084981-30085003 CGGGGAGAGGGGGCGGGGACGGG - Intronic
1146281967 17:31550350-31550372 CGGCGAGGGCGCACGCGGCGCGG - Intergenic
1147927192 17:43953275-43953297 CGGTGAGCGCAGGCGCGGAGCGG - Exonic
1148490980 17:48023937-48023959 CGGAGCCGGCGGGCGCGGAGGGG - Intergenic
1150217268 17:63477562-63477584 CGGCGAAGGCGGGCGCGGCCTGG - Intergenic
1150326682 17:64263317-64263339 CGGCGGCCGCGGGCGCGGGGCGG - Intergenic
1152212481 17:79009766-79009788 CGGGGCGAGCGCGCGCGGGGCGG - Exonic
1152435413 17:80273425-80273447 CAGAGTGAGCGGGGGCGGAGGGG - Intronic
1152581185 17:81166230-81166252 GGGCGGGAGCGCGCGCGGAGCGG + Intergenic
1152627880 17:81396569-81396591 CCGGGAGCGCGGGCGCGGTGGGG - Intronic
1152720946 17:81923641-81923663 CAGGGAGTGCGGGCGCGGCGGGG - Intronic
1152924151 17:83079874-83079896 CGGCGGGGGCGGGCCCGGGGCGG - Exonic
1155284211 18:24271884-24271906 CGGCCCGGGCGGGCGCGGCGCGG - Intronic
1155507632 18:26548422-26548444 GGGCGAGGGCGAGCGCGGCGCGG - Intronic
1160567943 18:79798483-79798505 CGCGGAGAGCGGGCGGGGTGTGG + Intergenic
1160807028 19:996430-996452 GTGCGGGAGCGGGCGTGGAGAGG - Intronic
1160832022 19:1108574-1108596 CAGCGCCAGCGGGCGCGGGGCGG + Exonic
1160864105 19:1249608-1249630 GGGCGGGGGCGGGCGCGGAGAGG + Intronic
1161006702 19:1940849-1940871 TGGCAACAGCGGGCGGGGAGGGG + Intergenic
1161104150 19:2434930-2434952 GGGTGAGTGCGGGCGCGGGGCGG + Intronic
1161264878 19:3359574-3359596 CGGCGAGGGAGGGCGCGCGGGGG - Intronic
1161304288 19:3558027-3558049 AGACGCGATCGGGCGCGGAGAGG + Intronic
1162413687 19:10521172-10521194 CTGCAAGAGCGGGCGCTGGGTGG - Intergenic
1162485994 19:10960957-10960979 CGGCGAGCGCGCGCGCAGCGGGG + Intergenic
1162486140 19:10961433-10961455 CGGCGAGAGCGCGCGCGGAGAGG - Intronic
1162744106 19:12789658-12789680 CGGCCCGACGGGGCGCGGAGAGG - Intronic
1163147169 19:15387957-15387979 CTGGGAGAGGGGGCGGGGAGGGG + Intronic
1164594799 19:29525972-29525994 CGGGGAGAGGGGGAGGGGAGGGG - Intergenic
1164594820 19:29526017-29526039 CGGGGAGAGCGGGTCCGGCGTGG - Intergenic
1165296132 19:34927252-34927274 CGGCGAGTGCGGGAGCGGCAGGG + Exonic
1165419993 19:35717930-35717952 GGGAGAGAGCGGGGGCGGGGCGG - Intergenic
1165479495 19:36054288-36054310 CGGCGAGCGCGGGTGGGGCGGGG - Exonic
1166306852 19:41940242-41940264 CGGGGAGCCCGGGGGCGGAGGGG + Intergenic
1166330640 19:42076289-42076311 GAGCGCGAGCGGGCGCGCAGAGG + Intronic
1167134284 19:47608199-47608221 CGGCCAGAGCGGCCGGGGACAGG + Exonic
1167464377 19:49642389-49642411 CGGCGAAACCTGGCGCCGAGAGG + Intronic
926217118 2:10912404-10912426 CTGCGAGGGCGCGCGCGGGGAGG + Exonic
926268214 2:11344799-11344821 AGGCGAGGGCGGGCGAGGAAGGG - Intronic
927203670 2:20593694-20593716 GGGTGAGAGCGGGCGCAGTGGGG - Intronic
927495218 2:23547294-23547316 CGGCCAGAGCTGGGGCAGAGGGG + Intronic
927520687 2:23696291-23696313 CAGAGAGAGCGGGCGGGGTGAGG - Intronic
927698306 2:25252150-25252172 CGGGGAGACCGGGGGCGGGGAGG - Intronic
929151230 2:38750914-38750936 CGCCGAGGGCGGGGGGGGAGGGG + Intronic
929720408 2:44362037-44362059 CGGCGAGACCGCGCGAGCAGCGG + Exonic
932616118 2:73232836-73232858 CGGCGCTAGTGGGCGGGGAGGGG + Intronic
934966818 2:98730991-98731013 GGGCGGGAGGGGGCGCGGGGCGG - Intronic
938414583 2:131093561-131093583 GCGCGAGCGCGAGCGCGGAGTGG + Intergenic
941367025 2:164621561-164621583 CGGCGAGGCAAGGCGCGGAGGGG + Exonic
942277249 2:174332442-174332464 CGGCGGGAGGGGGAGGGGAGGGG + Intergenic
944495906 2:200306966-200306988 GGGCGCGGGCGGACGCGGAGGGG + Intronic
944831209 2:203535309-203535331 CGGCGGGAGCGGGGGCGGGGCGG + Exonic
945080922 2:206085663-206085685 CGGCGACGGCGGGCGGGCAGGGG - Intronic
946175270 2:217918745-217918767 CGAGGAGGGCGGGCGGGGAGGGG - Intronic
948860544 2:240750692-240750714 CAGCAAGAGCGGGCGGGGACAGG + Intronic
1169088362 20:2840930-2840952 CGGGGAGAGCCGGCGCGGGGCGG - Intronic
1171012974 20:21518495-21518517 CGGCTGGAGCGGGCGCGGGGAGG + Intergenic
1172117978 20:32583312-32583334 CGGCCCGGGCGGCCGCGGAGGGG + Intronic
1172284621 20:33732087-33732109 CGGCGGGAGGGGGCGCAGCGCGG - Intronic
1173166348 20:40689403-40689425 CGGCCCGAGCGGCCCCGGAGCGG + Intergenic
1173726893 20:45304590-45304612 CGGCGAGAGAACGCGCGGAGAGG + Exonic
1173843504 20:46174255-46174277 AGGCGAGACCGGGCACGGTGTGG - Exonic
1173865950 20:46312751-46312773 CGGAGAAAGCGGGCTCGCAGAGG - Intergenic
1174607077 20:51768599-51768621 CGGAGCGAGCGGGCGCAGCGCGG - Exonic
1175847114 20:62065018-62065040 CGGCGGGCGCGGGGGCGGCGGGG + Exonic
1175847306 20:62065555-62065577 CGCCGAGGGCGCGCCCGGAGCGG - Exonic
1178992504 21:37367312-37367334 CGGCGAGGCCGGGCGCCGAGCGG - Intronic
1179674771 21:42974220-42974242 CGGCAACCGAGGGCGCGGAGGGG + Intergenic
1180650215 22:17370304-17370326 CGGCGGGGCCGGGCGCGGGGGGG + Intronic
1180782402 22:18528615-18528637 CGGCGCGGGAGCGCGCGGAGCGG + Exonic
1180871605 22:19150006-19150028 CTGGGTGAGTGGGCGCGGAGCGG - Exonic
1181239291 22:21467950-21467972 CGGCGCGGGAGCGCGCGGAGCGG + Intergenic
1181491386 22:23262717-23262739 GGGTGAGGGCGGGGGCGGAGAGG + Intronic
1181831617 22:25564807-25564829 CGGCGCGCGAGGGGGCGGAGCGG + Intergenic
1182072887 22:27475917-27475939 AGGCGAGAGAGGGCACAGAGAGG - Intergenic
1182475528 22:30574608-30574630 GCGCGGGAGCGGGCGCGGCGCGG - Intergenic
1182475534 22:30574625-30574647 GGCCGGGAGCGGGCGCGGCGCGG - Intergenic
1183411704 22:37658791-37658813 CTGCGAGAGGCTGCGCGGAGCGG + Exonic
1183578256 22:38706159-38706181 CGGCGGCGGCGGGCGCTGAGGGG + Intronic
1184059351 22:42072869-42072891 CGGCAAGAGCGGGGAGGGAGAGG - Intergenic
1184101540 22:42343861-42343883 CGGGGAGAGCGGGCGGAGGGCGG + Intergenic
1184265176 22:43342807-43342829 CTGGGAGAGGGGGCGCGGGGCGG - Intronic
1184276454 22:43411878-43411900 CGGGGAGGGCGGGCGTGGGGAGG + Intronic
1184412231 22:44331877-44331899 CGGCGGCGGCGGGCGCGGCGCGG - Intergenic
1184445306 22:44543762-44543784 CGGCGGGGGCGGGCGGGGGGCGG + Intergenic
1184680745 22:46071202-46071224 CGGCGGGAGGGGCCGCGGGGCGG + Intronic
1184680948 22:46071841-46071863 CGGAGAGGGCGAGCGCGGCGCGG - Intronic
1184759747 22:46537630-46537652 CGGGGAGAGCGCGGGCGGAGTGG - Intergenic
1185271082 22:49929553-49929575 CGGCGGGAGCGGGCGGGGCGCGG - Intergenic
1185272487 22:49935592-49935614 CGGGGAGTGGGGGCGCGGGGAGG + Intergenic
949860646 3:8501738-8501760 GCGCGAGCGCCGGCGCGGAGTGG + Exonic
950040176 3:9915136-9915158 GGGCGGGGGCGGGGGCGGAGAGG + Intronic
950683874 3:14602882-14602904 CGGTGAGCGCGCGCGCGGCGCGG - Intergenic
950683992 3:14603228-14603250 CGGTGGGGGCGGGCGCGGAGAGG + Intergenic
954313831 3:49790180-49790202 AGGAGAGAGGGGGCGGGGAGAGG - Intergenic
958609135 3:96401703-96401725 AGGCGAGAGAGGGAGCGGGGTGG - Intergenic
964087550 3:152835636-152835658 CCGCGGGAGGGGGCGCGCAGGGG - Exonic
968086342 3:195875646-195875668 GGGAGAGAGAGGGCGCGGACAGG - Intronic
968620775 4:1602658-1602680 CGGGGAGGGGGCGCGCGGAGGGG - Intergenic
968965560 4:3767523-3767545 GGCGGCGAGCGGGCGCGGAGGGG + Exonic
970408702 4:15787188-15787210 CGGCCAGAGTGGGCGCGCAGAGG + Intronic
970585706 4:17512164-17512186 CGGCAGCAGCGGGCGCGGAGCGG - Exonic
971757566 4:30721998-30722020 CGGCGAGAGCCGGCGCGCCGGGG + Exonic
973916287 4:55637330-55637352 GGGGGAGAGGGGGCGGGGAGGGG - Intergenic
976390193 4:84498309-84498331 CGCCGAGGGCGCGAGCGGAGAGG + Exonic
978503647 4:109434122-109434144 GGACGGGAGCGGGCGCGGTGCGG + Intronic
980906920 4:138957312-138957334 CGGGGAGAGTGGGCATGGAGGGG + Intergenic
983656484 4:170089997-170090019 GGGCGGGAGGGGGCGCGGCGAGG - Intronic
986337708 5:6767569-6767591 TGGAGAGAGAGGGCCCGGAGTGG - Intergenic
989379361 5:40798228-40798250 CGCCGGGGGCGGGCGGGGAGGGG + Exonic
991371610 5:65925708-65925730 CGGCGGGGGCGGGGGCGGGGCGG - Intergenic
992249916 5:74866416-74866438 CGGTGGGCGCGGGCGCGGAGCGG - Intronic
994043543 5:95284443-95284465 CGGCGGGGGCGGGCGCGCTGGGG - Exonic
999727200 5:154446537-154446559 CGGCAAGCGCGGCCGCGGAGTGG + Exonic
1000071405 5:157743957-157743979 CGGCGGGCGCGGGCGCGGGCGGG + Exonic
1001734908 5:173989605-173989627 GGGCGGGACCGGGCGCGGCGGGG + Intronic
1002140235 5:177133529-177133551 GGCCGCGAGCGGGCGCGCAGGGG + Intronic
1002532785 5:179858671-179858693 CGGGGACAGCGGACGGGGAGTGG - Intronic
1002711095 5:181195438-181195460 CCGCGAGAGCGTGCGCCGAAAGG - Exonic
1002714331 5:181217094-181217116 GGGCGGGGGCGGGGGCGGAGGGG + Intergenic
1003290867 6:4776884-4776906 CGGCGGGCGCGGGCGGCGAGCGG - Intronic
1003645602 6:7910866-7910888 CGGCGCGGGCGGGCGGGGAGAGG - Intronic
1004396216 6:15248412-15248434 AGGGGAGAGCGCGCGGGGAGGGG + Intronic
1005871267 6:29975729-29975751 CGGCTAGAGCGGGAGCGGCTTGG - Intergenic
1006171672 6:32096793-32096815 TGGCGAGGGCGGGCGCTGCGTGG - Intronic
1006304129 6:33208667-33208689 GGGCGGGAGCGGGGGCGGAGAGG + Intronic
1006671448 6:35731982-35732004 AAGTGAGAGCGGGGGCGGAGCGG + Intergenic
1006937642 6:37729429-37729451 CGGAGAGAGCGGCAGGGGAGAGG + Intergenic
1007784069 6:44270463-44270485 CGGCGGGAGCGGGCGGGAGGCGG + Exonic
1008920876 6:56843481-56843503 CGGCGAGGGCGGGCGGGGGCCGG + Intronic
1013106184 6:107028338-107028360 CGGCGGGAGCGTGGGCGGGGCGG - Exonic
1013793634 6:113860242-113860264 AGGCGGCAGCGGGCGAGGAGGGG + Exonic
1015894981 6:138008367-138008389 CGGTGTGACCGGGCGCGGTGTGG - Intergenic
1016996171 6:149963794-149963816 CGGCGTGCGCGGGCCCCGAGCGG - Intergenic
1017880561 6:158560024-158560046 CGGCGGAAGAGGGCGCGGCGCGG - Intronic
1018400461 6:163415064-163415086 GAGCGGGAGCCGGCGCGGAGCGG + Exonic
1018859137 6:167698461-167698483 AGGCAAGAGCAGGCGGGGAGAGG + Intergenic
1019112198 6:169724770-169724792 CGGCGACCGCGAGCGCGTAGAGG - Intronic
1020238449 7:6374420-6374442 CGGCGCGGGCGGGAGCGGCGCGG + Intergenic
1020238562 7:6374801-6374823 CCGCGGGATCGGGCGCGGAGGGG + Intronic
1021998414 7:26201911-26201933 CGGCGAGAAGGGGAGGGGAGGGG - Intronic
1023965844 7:44962723-44962745 CGGCGGGTGCGGGCGCTCAGCGG + Exonic
1028417634 7:90596547-90596569 CGGCGAGGGCGCGCGCCGCGGGG - Intronic
1029110367 7:98210844-98210866 CGGGGAAAGCGGGCGGGGGGAGG + Intergenic
1029708330 7:102286811-102286833 CGGCGGGGGCGGGGGCGGGGCGG + Intronic
1030348246 7:108456457-108456479 CGGAGAGGGCGGGAGCGGCGGGG - Intronic
1035476104 7:159145051-159145073 CGGTGAGGAGGGGCGCGGAGCGG - Intergenic
1035747831 8:1974313-1974335 CGGTGACTGCGGGCGCGGCGCGG - Intronic
1036609154 8:10334849-10334871 CGGCCAGAGCGGGGGAGGGGTGG - Intronic
1037769534 8:21790175-21790197 CGGCGAGAGCGGGAGAGGCGCGG + Intronic
1037825300 8:22156817-22156839 CGGCGGGGGCGCGCGCGGGGCGG + Exonic
1038540213 8:28385479-28385501 GGGCGAGAGCGTGCGGGCAGAGG + Intronic
1039484254 8:37899050-37899072 CAGTGAGTGCGGGCGGGGAGGGG - Exonic
1042399633 8:68330978-68331000 CGGCGAGGGTGGGCGCGAGGCGG + Exonic
1042591767 8:70403655-70403677 CCGCGAGGGCGGGCGGGGGGCGG - Intronic
1043769693 8:84183177-84183199 CGGCGAGAGGGGGAGCCGAGCGG - Intronic
1044554011 8:93542444-93542466 CGGCCAGAGCGGGGGCCGGGGGG + Intergenic
1048981058 8:139703591-139703613 CACCGAGAGGGGGCGAGGAGGGG - Intergenic
1049109806 8:140635671-140635693 CGGCGGGAGCGGGAGCGGGAGGG + Intergenic
1049619183 8:143590157-143590179 CGGGGAGGGCGGGCACGGGGAGG - Intronic
1049803967 8:144530626-144530648 GAGCGAGGGTGGGCGCGGAGGGG + Intronic
1049891408 9:73550-73572 CAGCGAGCGGCGGCGCGGAGAGG - Intergenic
1050151533 9:2622696-2622718 CGGGGAGTGCGGGAGCGGACGGG + Intronic
1051418814 9:16870814-16870836 CGGCGAGGGCGCGCGCGGGCGGG - Intronic
1053435173 9:38069323-38069345 CTGCGGGAGCGGGCGGGGGGCGG - Intergenic
1056922348 9:90801859-90801881 AGGCGAGGGCGGGCGCAGCGCGG - Exonic
1059234533 9:112750784-112750806 CGGCGGGCTCGGGCGCGGAGCGG + Intergenic
1059321229 9:113471647-113471669 CGGAGAGAGAGAGCGGGGAGGGG - Intronic
1059324743 9:113497383-113497405 CGGCGACTGCGGCCGCTGAGAGG + Exonic
1060583432 9:124771274-124771296 CGGCGCGGAGGGGCGCGGAGCGG - Exonic
1061028927 9:128068145-128068167 CGGCGAAGCGGGGCGCGGAGGGG + Intronic
1061559498 9:131393871-131393893 CGGCGGGAGGGGGCTGGGAGGGG - Intergenic
1061727516 9:132589721-132589743 CCGCGAGAGAGGACGCCGAGGGG - Exonic
1062306101 9:135907775-135907797 CTGCGGAAGCGGGCGGGGAGGGG - Intergenic
1062392853 9:136340844-136340866 CGGCGAGTGGGGTGGCGGAGCGG - Intronic
1185459733 X:328696-328718 CGGGGAGGGGGGGCGGGGAGAGG - Intergenic
1185750825 X:2608903-2608925 CAGCAAGGGCGGGCGCGGAGAGG + Intergenic
1185889491 X:3811542-3811564 AGGCGAGAGGGGGAGGGGAGAGG + Intergenic
1186107926 X:6226762-6226784 CGGAGGGAGCAGCCGCGGAGTGG + Intronic
1189035684 X:37492004-37492026 CGGCGACAGCGGGCCCAGGGCGG - Intronic
1192425060 X:71068078-71068100 CGGCGCGAGCGGGAGGGGGGAGG - Intronic
1197746052 X:129932624-129932646 CGGCGAGCGAGCGAGCGGAGCGG - Intergenic
1199736792 X:150693325-150693347 GGGCGGGAGCGGGGGCGGGGAGG - Intronic
1200098186 X:153673857-153673879 TGGCGGGGGCGTGCGCGGAGGGG - Intronic