ID: 1090091269

View in Genome Browser
Species Human (GRCh38)
Location 11:123700603-123700625
Sequence GTTTTCAAGGGGAATGAGGG AGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090091259_1090091269 30 Left 1090091259 11:123700550-123700572 CCAACAGTATGTTGAATAAGAGT No data
Right 1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG No data
1090091262_1090091269 -8 Left 1090091262 11:123700588-123700610 CCTTGTCTTGTGCCAGTTTTCAA 0: 9149
1: 4328
2: 2956
3: 2663
4: 2493
Right 1090091269 11:123700603-123700625 GTTTTCAAGGGGAATGAGGGAGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090091269 Original CRISPR GTTTTCAAGGGGAATGAGGG AGG Intergenic
No off target data available for this crispr