ID: 1090091736

View in Genome Browser
Species Human (GRCh38)
Location 11:123703994-123704016
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090091736_1090091747 20 Left 1090091736 11:123703994-123704016 CCCTAGAACAGGGGTGTCCAAAC No data
Right 1090091747 11:123704037-123704059 ATTGGAAGAAGAATTGTCTTGGG 0: 224
1: 429
2: 334
3: 297
4: 737
1090091736_1090091742 2 Left 1090091736 11:123703994-123704016 CCCTAGAACAGGGGTGTCCAAAC No data
Right 1090091742 11:123704019-123704041 TTGGCTTCCCTGGGCCACATTGG 0: 419
1: 887
2: 867
3: 500
4: 324
1090091736_1090091739 -8 Left 1090091736 11:123703994-123704016 CCCTAGAACAGGGGTGTCCAAAC No data
Right 1090091739 11:123704009-123704031 GTCCAAACTTTTGGCTTCCCTGG 0: 22
1: 750
2: 1031
3: 687
4: 422
1090091736_1090091746 19 Left 1090091736 11:123703994-123704016 CCCTAGAACAGGGGTGTCCAAAC No data
Right 1090091746 11:123704036-123704058 CATTGGAAGAAGAATTGTCTTGG 0: 215
1: 433
2: 341
3: 249
4: 314
1090091736_1090091740 -7 Left 1090091736 11:123703994-123704016 CCCTAGAACAGGGGTGTCCAAAC No data
Right 1090091740 11:123704010-123704032 TCCAAACTTTTGGCTTCCCTGGG 0: 25
1: 800
2: 1024
3: 615
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090091736 Original CRISPR GTTTGGACACCCCTGTTCTA GGG (reversed) Intergenic
No off target data available for this crispr