ID: 1090091738

View in Genome Browser
Species Human (GRCh38)
Location 11:123704000-123704022
Sequence AACAGGGGTGTCCAAACTTT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090091733_1090091738 -8 Left 1090091733 11:123703985-123704007 CCTTTGAGCCCCTAGAACAGGGG No data
Right 1090091738 11:123704000-123704022 AACAGGGGTGTCCAAACTTTTGG No data
1090091731_1090091738 -7 Left 1090091731 11:123703984-123704006 CCCTTTGAGCCCCTAGAACAGGG No data
Right 1090091738 11:123704000-123704022 AACAGGGGTGTCCAAACTTTTGG No data
1090091727_1090091738 28 Left 1090091727 11:123703949-123703971 CCACCAGAAGCTGGAAGAGGCAA 0: 98
1: 414
2: 982
3: 1599
4: 1970
Right 1090091738 11:123704000-123704022 AACAGGGGTGTCCAAACTTTTGG No data
1090091729_1090091738 25 Left 1090091729 11:123703952-123703974 CCAGAAGCTGGAAGAGGCAAGGA 0: 97
1: 417
2: 792
3: 1059
4: 1668
Right 1090091738 11:123704000-123704022 AACAGGGGTGTCCAAACTTTTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090091738 Original CRISPR AACAGGGGTGTCCAAACTTT TGG Intergenic
No off target data available for this crispr