ID: 1090091739

View in Genome Browser
Species Human (GRCh38)
Location 11:123704009-123704031
Sequence GTCCAAACTTTTGGCTTCCC TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2912
Summary {0: 22, 1: 750, 2: 1031, 3: 687, 4: 422}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090091737_1090091739 -9 Left 1090091737 11:123703995-123704017 CCTAGAACAGGGGTGTCCAAACT No data
Right 1090091739 11:123704009-123704031 GTCCAAACTTTTGGCTTCCCTGG 0: 22
1: 750
2: 1031
3: 687
4: 422
1090091733_1090091739 1 Left 1090091733 11:123703985-123704007 CCTTTGAGCCCCTAGAACAGGGG No data
Right 1090091739 11:123704009-123704031 GTCCAAACTTTTGGCTTCCCTGG 0: 22
1: 750
2: 1031
3: 687
4: 422
1090091735_1090091739 -7 Left 1090091735 11:123703993-123704015 CCCCTAGAACAGGGGTGTCCAAA No data
Right 1090091739 11:123704009-123704031 GTCCAAACTTTTGGCTTCCCTGG 0: 22
1: 750
2: 1031
3: 687
4: 422
1090091736_1090091739 -8 Left 1090091736 11:123703994-123704016 CCCTAGAACAGGGGTGTCCAAAC No data
Right 1090091739 11:123704009-123704031 GTCCAAACTTTTGGCTTCCCTGG 0: 22
1: 750
2: 1031
3: 687
4: 422
1090091731_1090091739 2 Left 1090091731 11:123703984-123704006 CCCTTTGAGCCCCTAGAACAGGG No data
Right 1090091739 11:123704009-123704031 GTCCAAACTTTTGGCTTCCCTGG 0: 22
1: 750
2: 1031
3: 687
4: 422

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090091739 Original CRISPR GTCCAAACTTTTGGCTTCCC TGG Intergenic
Too many off-targets to display for this crispr