ID: 1090091740

View in Genome Browser
Species Human (GRCh38)
Location 11:123704010-123704032
Sequence TCCAAACTTTTGGCTTCCCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2907
Summary {0: 25, 1: 800, 2: 1024, 3: 615, 4: 443}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090091731_1090091740 3 Left 1090091731 11:123703984-123704006 CCCTTTGAGCCCCTAGAACAGGG No data
Right 1090091740 11:123704010-123704032 TCCAAACTTTTGGCTTCCCTGGG 0: 25
1: 800
2: 1024
3: 615
4: 443
1090091735_1090091740 -6 Left 1090091735 11:123703993-123704015 CCCCTAGAACAGGGGTGTCCAAA No data
Right 1090091740 11:123704010-123704032 TCCAAACTTTTGGCTTCCCTGGG 0: 25
1: 800
2: 1024
3: 615
4: 443
1090091737_1090091740 -8 Left 1090091737 11:123703995-123704017 CCTAGAACAGGGGTGTCCAAACT No data
Right 1090091740 11:123704010-123704032 TCCAAACTTTTGGCTTCCCTGGG 0: 25
1: 800
2: 1024
3: 615
4: 443
1090091733_1090091740 2 Left 1090091733 11:123703985-123704007 CCTTTGAGCCCCTAGAACAGGGG No data
Right 1090091740 11:123704010-123704032 TCCAAACTTTTGGCTTCCCTGGG 0: 25
1: 800
2: 1024
3: 615
4: 443
1090091736_1090091740 -7 Left 1090091736 11:123703994-123704016 CCCTAGAACAGGGGTGTCCAAAC No data
Right 1090091740 11:123704010-123704032 TCCAAACTTTTGGCTTCCCTGGG 0: 25
1: 800
2: 1024
3: 615
4: 443

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090091740 Original CRISPR TCCAAACTTTTGGCTTCCCT GGG Intergenic
Too many off-targets to display for this crispr