ID: 1090091741

View in Genome Browser
Species Human (GRCh38)
Location 11:123704011-123704033
Sequence GCCCAGGGAAGCCAAAAGTT TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2909
Summary {0: 24, 1: 747, 2: 980, 3: 645, 4: 513}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090091741_1090091746 2 Left 1090091741 11:123704011-123704033 CCAAACTTTTGGCTTCCCTGGGC 0: 24
1: 747
2: 980
3: 645
4: 513
Right 1090091746 11:123704036-123704058 CATTGGAAGAAGAATTGTCTTGG 0: 215
1: 433
2: 341
3: 249
4: 314
1090091741_1090091747 3 Left 1090091741 11:123704011-123704033 CCAAACTTTTGGCTTCCCTGGGC 0: 24
1: 747
2: 980
3: 645
4: 513
Right 1090091747 11:123704037-123704059 ATTGGAAGAAGAATTGTCTTGGG 0: 224
1: 429
2: 334
3: 297
4: 737

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090091741 Original CRISPR GCCCAGGGAAGCCAAAAGTT TGG (reversed) Intergenic
Too many off-targets to display for this crispr