ID: 1090091742

View in Genome Browser
Species Human (GRCh38)
Location 11:123704019-123704041
Sequence TTGGCTTCCCTGGGCCACAT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2997
Summary {0: 419, 1: 887, 2: 867, 3: 500, 4: 324}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090091737_1090091742 1 Left 1090091737 11:123703995-123704017 CCTAGAACAGGGGTGTCCAAACT No data
Right 1090091742 11:123704019-123704041 TTGGCTTCCCTGGGCCACATTGG 0: 419
1: 887
2: 867
3: 500
4: 324
1090091731_1090091742 12 Left 1090091731 11:123703984-123704006 CCCTTTGAGCCCCTAGAACAGGG No data
Right 1090091742 11:123704019-123704041 TTGGCTTCCCTGGGCCACATTGG 0: 419
1: 887
2: 867
3: 500
4: 324
1090091735_1090091742 3 Left 1090091735 11:123703993-123704015 CCCCTAGAACAGGGGTGTCCAAA No data
Right 1090091742 11:123704019-123704041 TTGGCTTCCCTGGGCCACATTGG 0: 419
1: 887
2: 867
3: 500
4: 324
1090091736_1090091742 2 Left 1090091736 11:123703994-123704016 CCCTAGAACAGGGGTGTCCAAAC No data
Right 1090091742 11:123704019-123704041 TTGGCTTCCCTGGGCCACATTGG 0: 419
1: 887
2: 867
3: 500
4: 324
1090091733_1090091742 11 Left 1090091733 11:123703985-123704007 CCTTTGAGCCCCTAGAACAGGGG No data
Right 1090091742 11:123704019-123704041 TTGGCTTCCCTGGGCCACATTGG 0: 419
1: 887
2: 867
3: 500
4: 324

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090091742 Original CRISPR TTGGCTTCCCTGGGCCACAT TGG Intergenic
Too many off-targets to display for this crispr