ID: 1090091746

View in Genome Browser
Species Human (GRCh38)
Location 11:123704036-123704058
Sequence CATTGGAAGAAGAATTGTCT TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 1552
Summary {0: 215, 1: 433, 2: 341, 3: 249, 4: 314}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090091736_1090091746 19 Left 1090091736 11:123703994-123704016 CCCTAGAACAGGGGTGTCCAAAC No data
Right 1090091746 11:123704036-123704058 CATTGGAAGAAGAATTGTCTTGG 0: 215
1: 433
2: 341
3: 249
4: 314
1090091741_1090091746 2 Left 1090091741 11:123704011-123704033 CCAAACTTTTGGCTTCCCTGGGC 0: 24
1: 747
2: 980
3: 645
4: 513
Right 1090091746 11:123704036-123704058 CATTGGAAGAAGAATTGTCTTGG 0: 215
1: 433
2: 341
3: 249
4: 314
1090091733_1090091746 28 Left 1090091733 11:123703985-123704007 CCTTTGAGCCCCTAGAACAGGGG No data
Right 1090091746 11:123704036-123704058 CATTGGAAGAAGAATTGTCTTGG 0: 215
1: 433
2: 341
3: 249
4: 314
1090091735_1090091746 20 Left 1090091735 11:123703993-123704015 CCCCTAGAACAGGGGTGTCCAAA No data
Right 1090091746 11:123704036-123704058 CATTGGAAGAAGAATTGTCTTGG 0: 215
1: 433
2: 341
3: 249
4: 314
1090091731_1090091746 29 Left 1090091731 11:123703984-123704006 CCCTTTGAGCCCCTAGAACAGGG No data
Right 1090091746 11:123704036-123704058 CATTGGAAGAAGAATTGTCTTGG 0: 215
1: 433
2: 341
3: 249
4: 314
1090091737_1090091746 18 Left 1090091737 11:123703995-123704017 CCTAGAACAGGGGTGTCCAAACT No data
Right 1090091746 11:123704036-123704058 CATTGGAAGAAGAATTGTCTTGG 0: 215
1: 433
2: 341
3: 249
4: 314

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090091746 Original CRISPR CATTGGAAGAAGAATTGTCT TGG Intergenic
900090893 1:919995-920017 CATTTACAGAGGAATTGTCTGGG + Intergenic
900164423 1:1239108-1239130 CCTTGGAACAAGAATGGCCTGGG - Intergenic
900994730 1:6114422-6114444 CACTGGAAGAAGAACCGTCTTGG + Intronic
901241740 1:7698214-7698236 CAGAAGAAGAAGAATTGTCTTGG + Intronic
901257288 1:7841058-7841080 TGTAAGAAGAAGAATTGTCTTGG + Intronic
901683972 1:10933460-10933482 CAGTGGAAGAAGAACTGTCTTGG - Intergenic
901952934 1:12762858-12762880 CATTGGAAGAAGAATTGTCTTGG + Exonic
902035375 1:13454274-13454296 CAATAGAGGAAGAATTATCTTGG - Intergenic
902128477 1:14237902-14237924 AATTGGAAGAAGAACTCTCTAGG - Intergenic
902131709 1:14267301-14267323 CACTGGAAGAAGAATTGTCTTGG + Intergenic
902200871 1:14832544-14832566 CACTGGAAGAAGAATTGTCTTGG + Intronic
902284197 1:15395850-15395872 CACTGGAAGAAGAATAGTCTTGG - Intronic
902938805 1:19784779-19784801 CACTGGAAGAAGAATTGGTTTGG + Intronic
903042178 1:20539500-20539522 CTCTGGAAGAAGAATTGTCTTGG + Intergenic
903137682 1:21319965-21319987 CAATGTAAGAAATATTGTCTTGG + Intronic
903587230 1:24425375-24425397 CATTGGAAGAAGAATTGTCTTGG - Intronic
903630628 1:24766965-24766987 CACTGGAAGAAGAATTACCTTGG + Intronic
903738069 1:25543153-25543175 CATTGGAAGAAGAAGTGTCTTGG - Intergenic
904405040 1:30282909-30282931 CATTGGAAAAAGAATTGTCTTGG - Intergenic
904984210 1:34531438-34531460 CATTGAAAGAAGAATTGTCTTGG + Intergenic
905141326 1:35847114-35847136 CATTGGAAGAAGAATTTTCTTGG + Intronic
905373992 1:37505542-37505564 CATTGGAAGAAGAATTTTCTAGG - Intronic
905672065 1:39798271-39798293 CATTGGAAGAAGAATTGTCTTGG + Intergenic
905746892 1:40425809-40425831 CATTGGAAGAAGAACTGTCTTGG + Intergenic
905959295 1:42030309-42030331 CATTAGAAGAAGAATTGTCTTGG - Intronic
906371668 1:45258967-45258989 CAGTGGAAGAAGAATAGTCTTGG + Intronic
906390976 1:45416006-45416028 TATTGGAAGAAGAATTATCTGGG - Intronic
906872208 1:49495416-49495438 TGTTGGAAGGATAATTGTCTTGG - Intronic
907086021 1:51674844-51674866 CATTGGAAGAAGAATTGTCTTGG + Intronic
907196257 1:52689521-52689543 CATTGGAAGAAGAGTTGTCTTGG - Intronic
907258003 1:53194962-53194984 CACTGGAAGAAGAATTGTCTTGG - Intergenic
907349868 1:53819886-53819908 CACTGAAAGAAGAATTGTCTTGG + Intronic
907601762 1:55778872-55778894 CAGTGGGAGAATTATTGTCTTGG - Intergenic
907655359 1:56336760-56336782 CATTAGAAGAAGAATTATCTTGG - Intergenic
907895856 1:58690735-58690757 CACTGGAAGAAGAATTTTCTTGG - Intronic
908282165 1:62551283-62551305 TACTGGAAGAAGAATTGTCTTGG + Intronic
908325242 1:63017194-63017216 CACTAGAAGAAGAATTGTCTTGG + Intergenic
908588586 1:65603753-65603775 CACTGGAAGAAGAACTGTCTTGG - Intronic
909330429 1:74402926-74402948 CATTGGAAGAAGAATTGTCTTGG - Intronic
909330680 1:74406379-74406401 CACTGGAAGAAGAATTGTCTTGG - Intronic
909389168 1:75098666-75098688 CATTGGAAAGGGAATTGTCTTGG - Intergenic
909475969 1:76081221-76081243 CATTGGAAGAAGAATTGTCTGGG + Intronic
909582734 1:77256330-77256352 CATTGCAAGAAGAATTGTCTTGG - Intergenic
909630808 1:77768004-77768026 CACTGGAAGAAGAATGGCGTTGG - Intergenic
909747688 1:79119082-79119104 CATTGGAAGAAGAATTGTCTCGG + Intergenic
910072008 1:83227860-83227882 CATTGGAAGAAGAATTGTCTTGG + Intergenic
910160387 1:84266185-84266207 CAGTGGAAGAAAAATTGTCTTGG + Intergenic
910515749 1:88058082-88058104 CATTGTAAGAAAAATTATCCAGG + Intergenic
910536046 1:88298821-88298843 GAATGGAAGAAGAAATGTGTAGG + Intergenic
911014652 1:93319453-93319475 TGTTGGAAGAAGAATTGTCTTGG - Intergenic
911191089 1:94949163-94949185 CATTGGAAGAAGAATTGTCTCGG - Intergenic
911252059 1:95587522-95587544 CACTGGAAGAAGAATTGTCTTGG - Intergenic
912146059 1:106795824-106795846 CATAGGAAGCAGAATTGCCTGGG - Intergenic
912328204 1:108789376-108789398 CACTGGAAGAAGAACTGTCTTGG - Intronic
912399657 1:109379237-109379259 CACTGGCAGAAAAATTGTCTTGG + Intronic
912620891 1:111156511-111156533 TGTTGGAAGAAGAATTGTCTTGG + Intronic
912933952 1:113986631-113986653 CATTGGAAGAAAAATTGTCTTGG + Intergenic
913048485 1:115094132-115094154 CATTAGAAGAATAATTGTCTTGG + Intergenic
913394271 1:118349235-118349257 CATTGGAAGAAGAATTGTCTTGG - Intergenic
913690296 1:121273401-121273423 CATTGGAATAAGTTTTGTCAAGG + Intronic
913703869 1:121398557-121398579 CATTGGAAGAAGAATGCTCCTGG + Intergenic
913942520 1:125121060-125121082 CATTGGAAGAAGAATGCTCCTGG + Intergenic
913980220 1:143500263-143500285 CATTGGAAGAAGAATGCTCCTGG + Intergenic
914074569 1:144325751-144325773 CATTGGAAGAAGAATGCTCCTGG + Intergenic
914104607 1:144640695-144640717 CATTGGAAGAAGAATGCTCCTGG - Intergenic
914147246 1:145006558-145006580 CATTGGAATAAGTTTTGTCAAGG - Intronic
914972652 1:152324714-152324736 TAATGGAAAAAGAATTGTCTTGG - Intronic
914976474 1:152368290-152368312 CGTTTGAAGAAGAATTGTCTTGG + Intergenic
915215301 1:154336383-154336405 CATTGGAAGAAGAATTGTCTTGG + Intronic
915359312 1:155276644-155276666 GAATGGAAGAAGAATTGGCCTGG + Intronic
915617394 1:157049738-157049760 CACTGGAAGAAGAATTGTCTTGG - Intergenic
915617532 1:157050993-157051015 CATGGGAAAAAGAAGTCTCTGGG - Intergenic
915641561 1:157231195-157231217 CTTTGGAAGAAGAATTATCTTGG - Intergenic
916049841 1:161028585-161028607 CACTGGAAGAAGAATTGTCTTGG + Intronic
916492133 1:165311407-165311429 CAGTGGAAGTAGAATGGGCTTGG - Intronic
916669201 1:166997137-166997159 CATTGGAAGAAGAATTGCCTTGG + Intronic
916730847 1:167565383-167565405 CATTGGAAGAAAAATTGTCTTGG + Intergenic
916745389 1:167681092-167681114 CAATGGAAGAAGTGTGGTCTTGG - Intronic
916796078 1:168168689-168168711 CATTAGAAGAAGAATTGTCTTGG - Intergenic
917179353 1:172278356-172278378 CATTGGAAGAAGAATTGTCTTGG + Intronic
917543055 1:175934218-175934240 CACTGGAAGAAGAATTGTCTTGG - Intergenic
917773222 1:178303395-178303417 CATCAGAAGAAGAATTGTCTTGG + Intronic
917806988 1:178622618-178622640 CACTGGAAGGAGAATTGTCAGGG + Intergenic
917955521 1:180093172-180093194 CAAAGGAAAAAGATTTGTCTTGG + Exonic
918290250 1:183100463-183100485 CATAGGAATTAGAGTTGTCTAGG - Intronic
918527161 1:185477745-185477767 CAGTAGAAGAAGAATTGTCTTGG - Intergenic
918540388 1:185625851-185625873 CACTGGAAGAATAATTGTTTTGG - Intergenic
918737289 1:188080961-188080983 CATTGGAAGAAAAATTGTCTTGG + Intergenic
918741057 1:188130876-188130898 AATTGGGATAATAATTGTCTTGG + Intergenic
919005238 1:191890656-191890678 CACTGGAAGAAGATTTGTCTTGG + Intergenic
919434787 1:197544609-197544631 TAGAGAAAGAAGAATTGTCTTGG + Intronic
919491997 1:198215535-198215557 CAGAAGAAGAAGAATTGTCTTGG - Intronic
919499739 1:198322756-198322778 CATTGGAAGAAGAATTGTCTTGG + Intergenic
919736327 1:200954179-200954201 TATTGGAAGAAGAATTGTCTTGG + Intergenic
919891862 1:201981479-201981501 CATAGGAAGAGGAATTGTGCCGG + Intergenic
920137376 1:203780895-203780917 CATTGAAAGAAGAATTGACTGGG + Intergenic
920241185 1:204551914-204551936 CAATGGAAGAAGAATTGTCTTGG + Exonic
920318210 1:205095435-205095457 CATTGGAAGAATAATTGTCTTGG - Intronic
920372479 1:205488007-205488029 CATTGGAAGAAGAACTGTCTTGG + Intergenic
920477616 1:206291889-206291911 CATTGGAATAAGTTTTGTCAAGG + Intronic
920493311 1:206436141-206436163 CATTGGAAGAAAAATTGTCTTGG - Intronic
920634353 1:207685071-207685093 AATTGGAATAGGAATTTTCTTGG + Intronic
920892814 1:210008960-210008982 CATGGGAAGAAGAATGGTCTTGG + Intronic
920988698 1:210915126-210915148 CAAAGGAAGAAGAATTGTCAGGG - Intronic
921118394 1:212115718-212115740 CATTGGAAGAAGGATTGTCTTGG + Intergenic
921210298 1:212890395-212890417 CATTGGAACAAGAAATATCTTGG + Intronic
921247148 1:213256470-213256492 CATTGAAAGAAGAATTGTCTTGG + Intronic
921555118 1:216589428-216589450 CATCAGAAGAAGAATTGTCTTGG - Intronic
921564746 1:216703238-216703260 CATAGGAAAAAGAATTGTCTTGG + Intronic
921595221 1:217047336-217047358 CACTGGAAAAAGAATTGGTTGGG - Intronic
921596385 1:217057878-217057900 CGTTGGAAGAAGATTTATCTTGG - Intronic
921660178 1:217792008-217792030 AAGAAGAAGAAGAATTGTCTTGG + Intronic
921691719 1:218158717-218158739 CACTGGAAGAAGAATTGTCTTGG - Intergenic
921819366 1:219599634-219599656 CATTGGAATGAGAAGTGTTTTGG + Intergenic
921935236 1:220789372-220789394 CATTGGAAGAAGAATTGTCTTGG + Intronic
922307744 1:224358636-224358658 CACTGGAAGAAGAATTGCCTTGG - Intronic
922566170 1:226603136-226603158 AATTGCAAGAACAATTGTATGGG + Exonic
922629389 1:227089886-227089908 CATTTTAAGAAAAATTGTATTGG - Intronic
922641343 1:227234971-227234993 CATTGGAAAAAGAATTGTCTTGG - Intronic
922755676 1:228095580-228095602 CAATGGAAGAAGAATTGTCTTGG - Intronic
922944888 1:229505097-229505119 ACTTGGAAGAAGAATTGTCTTGG - Intronic
923493820 1:234507521-234507543 CTCTGGAAGAAGAACTGTCTTGG + Intergenic
923660794 1:235955392-235955414 CATCAGAAGAAGAATTGTCTTGG - Intergenic
924121163 1:240799600-240799622 CATTGCAAGAAGAATTATCTTGG + Intronic
924359656 1:243224392-243224414 CACTGGAAGAAGAATTGTCTTGG + Intronic
924405930 1:243745720-243745742 CATTGGAAGAGGAATTGTCTTGG - Intronic
924416864 1:243864920-243864942 CACTGGAAGAAGAATTGTCTTGG + Intergenic
924942150 1:248819332-248819354 CACTGGAAGAAGAACTGTCCTGG + Intronic
1062977601 10:1697027-1697049 CATCAGAAGAAGAACTGTCTTGG - Intronic
1063018299 10:2100604-2100626 CAGAAGAAGAAGAATCGTCTTGG + Intergenic
1063239806 10:4156692-4156714 CATTGGAGGCAGGACTGTCTGGG - Intergenic
1063487732 10:6435639-6435661 CATTGGAAGAAGGATTGTCTTGG + Intronic
1063524537 10:6772641-6772663 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1063880366 10:10525417-10525439 CATTGGAAGAAGAATTGCCTGGG - Intergenic
1064039656 10:11949144-11949166 AACAGGAAGAAGAATTGACTGGG - Intronic
1064054141 10:12083217-12083239 CATTGGAATTAGAATTGTCTTGG + Intronic
1064070136 10:12221854-12221876 CATTAGAGGAAGAATTGTCTTGG - Intronic
1064167345 10:12997854-12997876 CATTGGAAGAAGAATTGTCTTGG + Intronic
1064305806 10:14164938-14164960 CACTGGAAGGAGAATTGTCTTGG - Intronic
1064369070 10:14735346-14735368 CATTGAGAGAAGAATTGTCTTGG - Intronic
1064918251 10:20486579-20486601 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1065053905 10:21823672-21823694 CAGTGGAAGAAGAGTTGTCTTGG + Intronic
1065124055 10:22555831-22555853 CACTGGAAGAAGAATTGTCTTGG + Intronic
1065212889 10:23421732-23421754 CATTGGAAGAAACATAGTTTTGG + Intergenic
1065241986 10:23714815-23714837 CATGGGCAGAAGCATGGTCTTGG + Intronic
1065700165 10:28417198-28417220 TAGAAGAAGAAGAATTGTCTTGG + Intergenic
1065750424 10:28881098-28881120 CAGAAGAAGAAGAATTGTCTTGG - Exonic
1065796423 10:29312442-29312464 TATTGGAAGAAGAATTGTCTTGG - Intronic
1066069203 10:31788641-31788663 CATTGAAAGAACAATTGTCTTGG + Intergenic
1066252192 10:33645218-33645240 CATTGAAAGAAGAATTGTCTTGG - Intergenic
1066264466 10:33762297-33762319 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1066283560 10:33941764-33941786 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1066291454 10:34017852-34017874 CATTGGAAGAAGAATTGTTTTGG + Intergenic
1066302276 10:34107583-34107605 CGTTGGAAGAAGAATTGTCTTGG + Intergenic
1066326900 10:34369394-34369416 CACTGGAAGAAGAATTGTCTTGG - Intronic
1066515576 10:36156164-36156186 TATTGAAAGAATAATTATCTTGG - Intergenic
1066780983 10:38944063-38944085 CATTGGAAGAAGAATGTTCCTGG + Intergenic
1066953899 10:42148057-42148079 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1067197137 10:44131704-44131726 CTTCTGAAAAAGAATTGTCTAGG + Intergenic
1068036769 10:51769783-51769805 CATTGGAAGAAGAATTGTCTTGG + Intronic
1068140681 10:53002919-53002941 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1068174108 10:53435277-53435299 CGCTGGAAGAAGAGTTGTCTTGG - Intergenic
1068247028 10:54386191-54386213 CAGTGAAAGAAGAATTGTTTTGG + Intronic
1068317268 10:55362897-55362919 CACTGGAAGAAGAATTGTCTTGG + Intronic
1068458075 10:57286022-57286044 TAGAAGAAGAAGAATTGTCTTGG + Intergenic
1068525132 10:58120102-58120124 CATTGGGAAAAGAACTGTCTTGG - Intergenic
1068581402 10:58744348-58744370 CTTTGGAAGAAAAATTGAGTGGG - Intronic
1068637867 10:59367820-59367842 CATTGGAAGAAGAATTGTGTTGG - Intergenic
1068707848 10:60096627-60096649 CATTTGAAAAAGTAATGTCTTGG + Intronic
1068774537 10:60855960-60855982 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1069204169 10:65661127-65661149 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1069427672 10:68303379-68303401 CAATGTAATAAAAATTGTCTGGG - Intronic
1069575740 10:69527230-69527252 CGTTGGAAAAAGAATTGTCTTGG + Intergenic
1069728706 10:70597778-70597800 CGTTGGAAGAAGAATTGTGTTGG + Exonic
1070260339 10:74848611-74848633 CACTGGAAGAAGAATTGTCTAGG - Intronic
1070762509 10:79033341-79033363 CACTGGAGGAAGAATTGTCCTGG - Intergenic
1070872999 10:79774321-79774343 CATTGGGAGAAGAATTGTCTTGG - Intergenic
1071389142 10:85152869-85152891 CATTAGAAGAAGAATTTTCTTGG + Intergenic
1071555027 10:86594951-86594973 CATGGGAAGAATAATTGTCTTGG - Intergenic
1071612074 10:87040818-87040840 CATTGGAAGAATAATTGTCTTGG - Intergenic
1071639926 10:87296472-87296494 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1071655308 10:87441477-87441499 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1072034048 10:91548441-91548463 CATTGGAAAAAGAATTGTCTTGG - Intergenic
1072091124 10:92128260-92128282 CACTTGAAGAAGAATTGTCTTGG + Intronic
1072095663 10:92177002-92177024 CATTGGAAGAATAATTGTCCTGG - Intronic
1072150781 10:92681022-92681044 CACTGGAAGAAGAACTGTCTTGG + Intergenic
1072156453 10:92728346-92728368 TGATGGAAGAAAAATTGTCTTGG + Intergenic
1072262936 10:93699036-93699058 CATCGGAAGAAGAATTGTCTTGG - Intronic
1072357062 10:94622214-94622236 CATTAGAAGAAGAATTGTGTTGG + Intergenic
1072468771 10:95692827-95692849 CATTGGAAGAAGAATTGTCTTGG - Intronic
1072536162 10:96365049-96365071 CATTGGAAGAAGAATTATCTTGG + Exonic
1072789236 10:98305675-98305697 CAGTGGAAGAAGAATAGTCTTGG - Intergenic
1072793241 10:98334649-98334671 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1072952080 10:99856591-99856613 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1073065626 10:100757589-100757611 CTTTGGAGGAAGGATTGTGTTGG - Intronic
1073303082 10:102482715-102482737 CATTGGAAGAAGAATTGTCTTGG + Intronic
1073672659 10:105609321-105609343 CTTAGGAAGAAGAAATGTTTTGG - Intergenic
1073722814 10:106193126-106193148 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1073727322 10:106248268-106248290 CATTGGAAGTAGAATTGTCTTGG - Intergenic
1074118056 10:110472519-110472541 CACTGGAAGAAGAATTGCCTTGG + Intergenic
1074171928 10:110948996-110949018 CAATGGAAGAAGGATTGTCTTGG - Intronic
1074269900 10:111944079-111944101 CACAGGAAAAAGAATTGTCAGGG + Intergenic
1074327580 10:112467400-112467422 CATTGGAAGAAGAATTGTCTTGG + Intronic
1074604353 10:114945732-114945754 CAATGAAAGAAGAATTGTCTTGG - Intronic
1074638812 10:115354189-115354211 CATTAGAAGAAGAATTGTCATGG - Intronic
1074737403 10:116450343-116450365 CAGTGGAAGAAGAATTGTCTTGG - Intronic
1074989962 10:118696260-118696282 CACTAGAAGAAGAACTGTCTTGG + Intronic
1075303847 10:121349920-121349942 CCTTGGAAGAAGAAATCACTGGG - Intergenic
1075570733 10:123540906-123540928 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1075706245 10:124503391-124503413 TACTGGAAGAAGAAATGTCTTGG - Intronic
1075755763 10:124810119-124810141 CATTGGAAGAAGAATTGTCTTGG - Intronic
1076063942 10:127433896-127433918 TAGAAGAAGAAGAATTGTCTTGG - Intronic
1076075832 10:127533273-127533295 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1076145309 10:128114224-128114246 TATTAGAAGAAAAGTTGTCTGGG - Intronic
1076186608 10:128455016-128455038 CGTTGGAAGAAGAATTGTCTTGG + Intergenic
1076217469 10:128707601-128707623 CATATTAAGAAGAGTTGTCTGGG + Intergenic
1077769963 11:5206549-5206571 CAGTGGAATAAGAATAGTTTTGG + Intergenic
1078164225 11:8869042-8869064 CACTGGAAGAAGAATCGCCTGGG - Intronic
1078282097 11:9912643-9912665 CATTGGAAGAAGAATTGTGGTGG - Intronic
1078701879 11:13693128-13693150 CATTGGAAGAAGAATTATCTTGG + Intronic
1078859172 11:15231331-15231353 CACTGGAAGAAGAATTGTCTTGG + Intronic
1079041034 11:17059744-17059766 CATTGAAAAAAAAATTGGCTGGG + Intergenic
1079205162 11:18408583-18408605 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1079411821 11:20194909-20194931 CGTTGGAAGAAAAATTGTCTTGG - Intergenic
1079724065 11:23858012-23858034 CATTGGAAAAAGAATTGTCTTGG - Intergenic
1079818964 11:25100299-25100321 TATTGGAAGAAGAATTGTCTTGG - Intergenic
1080356878 11:31459161-31459183 GATTTGAAGAAGAATTACCTAGG + Intronic
1080395857 11:31889350-31889372 TGGAGGAAGAAGAATTGTCTTGG + Intronic
1080415543 11:32066672-32066694 CATTGGAAGAATAATTGTCTTGG + Intronic
1080485942 11:32706530-32706552 CATTAGAAAAATAATTGTCATGG + Intronic
1080754293 11:35180651-35180673 CATTGGGAGAAGAATTGTCTTGG + Intronic
1080755501 11:35193185-35193207 CATTGGAAGAAGAATTGTCCTGG + Intronic
1080856821 11:36119036-36119058 TATTGGAAGAAGAATTGCCTTGG + Intronic
1080882532 11:36336054-36336076 CATGGGAAGAAGGGTTGTCCAGG - Intronic
1081047087 11:38289126-38289148 CATTGGAAGAGGAATTGTCTTGG - Intergenic
1081828240 11:46080044-46080066 CATTAGATGAAAAATTGACTTGG - Intronic
1081936480 11:46907599-46907621 CACTGGAAGAAGGATTGTCTTGG - Intronic
1082089678 11:48079090-48079112 CACTGGAAGAAGAATTGTCTTGG + Intronic
1082221277 11:49640692-49640714 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1082853914 11:57789606-57789628 CAGTGGAAGAAGAATTGTGTTGG + Intronic
1082941592 11:58710821-58710843 CAGTGGAGTAAGAAGTGTCTGGG + Intronic
1083011092 11:59400259-59400281 CACTGAAAGAAGAATTGTCTTGG + Intergenic
1083052242 11:59787674-59787696 CATTGGAAGAAGAATTGTCTTGG + Intronic
1083529802 11:63409373-63409395 CAGTGGAATAAGAATTGTCTTGG + Intronic
1083537891 11:63488734-63488756 CACTGGAAGAAGAAACGTCTTGG - Intronic
1083927029 11:65813878-65813900 CATTGGAGGGCGAATTGTTTGGG - Intergenic
1084139836 11:67218932-67218954 CACTGGAAGAAGAATTGCTTGGG - Intronic
1084340043 11:68491804-68491826 CATTGGAAGAAGAGTTGCCTTGG + Intronic
1084397777 11:68925018-68925040 TAAAAGAAGAAGAATTGTCTTGG - Intronic
1084514071 11:69626401-69626423 CTTTGGAAGAAGAATTGTCTTGG - Intergenic
1084540936 11:69786768-69786790 CACTGGAAGAAGAATTGGCTTGG - Intergenic
1084555051 11:69871109-69871131 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1084560201 11:69900741-69900763 CATAGGAACAAGAAATTTCTTGG + Intergenic
1084614773 11:70228271-70228293 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1085075671 11:73589429-73589451 CACTGGAAGAAAAATTGACTTGG + Intronic
1085138026 11:74111843-74111865 CGTTGGAAGAAGAATTGTCTTGG - Intronic
1085291345 11:75402125-75402147 CGTTGGAAGAAGAAATGTCTTGG + Intronic
1085642638 11:78202279-78202301 CATTAGCAAAAGAATGGTCTAGG + Intronic
1085724458 11:78942043-78942065 TACTGGAAGAAAAATTGTCTTGG + Intronic
1085781118 11:79409981-79410003 CACTGGAAGAAGAACTGTCTTGG + Intronic
1085848231 11:80090547-80090569 CATTGAAAGAAGAATTATTTTGG - Intergenic
1086229972 11:84556466-84556488 CAATGGGAGAAGAATTGTCTTGG + Intronic
1086627765 11:88978408-88978430 CACTGGAAGAAGAATTGTCTTGG + Intronic
1087200980 11:95344468-95344490 TATTGGAAGAAGCATTGTCTTGG - Intergenic
1087328125 11:96747924-96747946 CATTGGAAGAAGAATTGTCGTGG - Intergenic
1087700830 11:101434618-101434640 CATTGGAAGAAGAAATGTCTTGG - Intergenic
1087706064 11:101493189-101493211 CATTGGAAGAAGAATTGTCTTGG + Intronic
1088157458 11:106825387-106825409 CATTGGAAGAAGAATTGTCTTGG + Intronic
1088157472 11:106825696-106825718 CACTGGAAGAAGAATTGTCTTGG + Intronic
1088202783 11:107358278-107358300 CATTGGAAGAAGAACCATCTTGG + Intronic
1088275813 11:108084044-108084066 CACTGGAAGAAGGACTGTCTTGG - Intronic
1088298540 11:108328700-108328722 CATTGCAAGAAGAATTGCCTTGG + Intronic
1088373525 11:109116667-109116689 CATTGGAAGAATAACTGTCTTGG + Intergenic
1088446230 11:109931728-109931750 CATTGGAAGAAGAATTGTTTTGG - Intergenic
1088941928 11:114468066-114468088 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1088942333 11:114472325-114472347 CTTTCAAAGAAGAATTGTCTTGG + Intergenic
1089019353 11:115196533-115196555 CATTGGAAGAAGAATTGTCTTGG + Intronic
1089024325 11:115253018-115253040 CACTGGAAAAAGAATTGTCTTGG + Intronic
1089470347 11:118715473-118715495 CTCTGGAAGAAGAATTGCCTTGG + Intergenic
1089891296 11:121884122-121884144 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1090091746 11:123704036-123704058 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1090129154 11:124121539-124121561 TATAAGAAGAAGAATTGTCTTGG - Intronic
1090198547 11:124838112-124838134 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1090253008 11:125264207-125264229 CAGTGGAAAATGGATTGTCTGGG + Intronic
1090342397 11:126036122-126036144 CATTGGAATAAGTTTTATCTGGG - Intronic
1090379521 11:126316387-126316409 CACTGGAAGAAGAACTGTCTTGG - Intronic
1090589786 11:128253062-128253084 CTGGAGAAGAAGAATTGTCTTGG + Intergenic
1090869517 11:130730935-130730957 CAGAAGAAGAAGAATTGTCTTGG - Intergenic
1091834770 12:3577732-3577754 CATTAGAAGAAGAACTGTCTTGG - Intronic
1092115097 12:5995114-5995136 CACTGGAAGAGGAATTGTCTTGG - Intronic
1092633723 12:10416401-10416423 CATTGGAAGAAGAAGAGTCTTGG - Intronic
1092634768 12:10431837-10431859 CGTTAGAAGACGAATAGTCTTGG - Intronic
1092635809 12:10447273-10447295 CATTGGAAGAAGAAGAGTCTTGG - Intronic
1092788437 12:12050731-12050753 CACTGGAAGAAGAATTGTCTTGG + Intronic
1093114267 12:15190247-15190269 CATTGGAAGAAGAATTGTCTTGG + Intronic
1093143971 12:15542273-15542295 CACTGGAAGAAGAATTATCTTGG + Intronic
1093262344 12:16954258-16954280 CATGGGAAGAAGAACTGTCCTGG - Intergenic
1093636042 12:21469432-21469454 CATTGGAAGAAGAATTGTCTTGG - Exonic
1093636056 12:21469741-21469763 CATTGGAAGAAGAATTGTCTTGG - Exonic
1093662945 12:21778007-21778029 TATTGGAAGAAGAATTGTCTTGG - Intergenic
1093999048 12:25674675-25674697 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1094032979 12:26034347-26034369 CATTGGAAGAAGAATTGACTTGG + Intronic
1094246734 12:28305695-28305717 CAATGGAAGAAGAGTGGTCACGG - Exonic
1094336414 12:29360845-29360867 CACTGTAAGAAGAATTATCTTGG + Intronic
1094487222 12:30934707-30934729 CATTGGAAGAAGAATTGTCTTGG - Intronic
1094608016 12:31966090-31966112 CTTTGGAAGAAGAATTGTCTTGG + Intronic
1094800751 12:34031934-34031956 TATTGGAAGAAGAACTGTCTGGG - Intergenic
1095279290 12:40331520-40331542 TATTGGAAGAAGAATTGCCTTGG + Intronic
1095397769 12:41780201-41780223 CATTGAAAGAAGAATTGTCTTGG - Intergenic
1095421646 12:42030586-42030608 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1095448033 12:42302030-42302052 CATTTCAAGAAGAATTGCCCAGG - Intronic
1095475450 12:42582875-42582897 CATTGGAAGAAGAATTGTCTTGG - Intronic
1095546201 12:43373441-43373463 CACTGGAAGAAGAATTGTCTTGG + Intronic
1095700540 12:45186612-45186634 CAATGGAAGAAGAATTGTCTTGG + Intergenic
1095768877 12:45928491-45928513 CATTGGAAGATGATTTTTCAGGG + Exonic
1096190234 12:49612591-49612613 CACTGGAAGAAGAATTGTCTTGG - Intronic
1096726180 12:53564944-53564966 CATTGGAAGAAGAATTGTCTTGG - Intronic
1096735220 12:53647959-53647981 AATTGGAAGCAAAATTTTCTAGG - Intronic
1097308374 12:58093552-58093574 AATTGGTACAAGAGTTGTCTGGG - Intergenic
1097830285 12:64217405-64217427 TAGAAGAAGAAGAATTGTCTTGG + Intronic
1097937721 12:65272263-65272285 GATTGGAAGAAGAGTAGTGTTGG - Intergenic
1098005336 12:65990637-65990659 CATTAGAAGAAGAATTATCTTGG - Intergenic
1098241825 12:68475722-68475744 CATTGGAAGAAGAATCGTCTTGG - Intergenic
1098389038 12:69949711-69949733 CACTGGAAGAAGAATTGTCTTGG - Intronic
1098411916 12:70195250-70195272 CATTGGCAGAAGAATTGTCTTGG + Intergenic
1098470176 12:70833860-70833882 CTTTTGAAGAAGAATTGCATGGG - Intronic
1098606889 12:72402203-72402225 TGTTGGAAGAAGAATTGTTTTGG + Intronic
1098762269 12:74439077-74439099 CATTTGAACAAGAATTCCCTTGG + Intergenic
1099031895 12:77536377-77536399 CACTGGAAGAAGAATTGCTTTGG - Intergenic
1099162052 12:79254125-79254147 CATTGGAAGAAGACTTTCATAGG + Intronic
1099205261 12:79719550-79719572 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1099334814 12:81341630-81341652 CATTAGAAGAAGAATTGTCTTGG - Intronic
1099384233 12:81995400-81995422 TGGAGGAAGAAGAATTGTCTTGG - Intergenic
1099469442 12:83029379-83029401 CATTGGAAGAAGAATTGTCTTGG - Intronic
1099471230 12:83051356-83051378 CATTGGAAGAAGAATTGTCTTGG - Intronic
1099942207 12:89201991-89202013 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1100402498 12:94244656-94244678 CATTGGAAGAAGAATTGTCTTGG + Intronic
1100419694 12:94420645-94420667 CACTGGAAGAAGAATTATCTTGG - Intronic
1100435346 12:94566036-94566058 TATTGGAAGAAGAATTGTCTTGG - Intergenic
1100553179 12:95666639-95666661 CATAGGAAGTAGAATTATCCTGG + Intronic
1101129705 12:101676143-101676165 CCCTGGAAAAAGAATTGTCTTGG - Intronic
1101140562 12:101791395-101791417 CAGTGGGAGAAGAATTGTCTTGG + Intronic
1101362690 12:104042703-104042725 CACTGAAAGAAGAATTGTCTTGG + Intronic
1102265376 12:111479773-111479795 TATTGGAAGAAGAATTGTGTTGG - Intronic
1102331738 12:112038650-112038672 CACTGGAAGAAGAATTGTCTTGG + Intronic
1102766039 12:115433788-115433810 CACTGGAAGAAGAATTTTCTTGG + Intergenic
1102843034 12:116146499-116146521 TGCTGAAAGAAGAATTGTCTTGG - Intronic
1103312581 12:120023148-120023170 CATCAAAAGAAGAATTGTCTAGG + Intronic
1103926326 12:124425480-124425502 CACTGGAAAAAGAAATGTCTTGG - Intronic
1103947388 12:124533991-124534013 CATTGGAAGAAGAATTGTCTTGG - Intronic
1104138168 12:125960240-125960262 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1104233313 12:126906751-126906773 CATTGGAAGATGTACTTTCTTGG + Intergenic
1104304275 12:127595073-127595095 CACTGGAAGAATGATTGTCTTGG - Intergenic
1104374431 12:128251189-128251211 CATTGTAAAAAGAATTGTCTTGG + Intergenic
1104658877 12:130594498-130594520 CATTGGAAGAAGAATTGTCTTGG + Intronic
1105254288 13:18731196-18731218 CATTGGAAGAATAATTTTCTTGG - Intergenic
1105388125 13:19951080-19951102 CACTGGAAGAATTATTGTCTTGG - Intergenic
1105459246 13:20567947-20567969 CATCGGAAGAAGAATTGTCTTGG + Exonic
1105480229 13:20768636-20768658 CATTGGAAGAAGAATTGTCTTGG - Intronic
1105508570 13:21032630-21032652 CATTAGAAGAAGAATTGTCTTGG - Intronic
1105728184 13:23186329-23186351 CATTCTGACAAGAATTGTCTGGG - Intronic
1105784835 13:23738365-23738387 CATTGGAAGAAGAATTGTCTTGG - Intronic
1106089764 13:26580079-26580101 CACTGGAAGAAGAATTGTCTTGG - Intronic
1106284292 13:28305833-28305855 CAATGGAAGAATAATTATCTTGG - Intronic
1106370336 13:29126687-29126709 CATTGAAAGAAGAATTGTCTTGG - Intronic
1106549033 13:30755554-30755576 CACTGGAAGAAGAGTTGTCTTGG + Intronic
1106573719 13:30955108-30955130 CAGTGGAAGAAGAATTGCTTTGG + Intronic
1106772251 13:32972878-32972900 CACTGGAAGAAGAATTTTGTTGG - Intergenic
1106981865 13:35294988-35295010 CACTGGAAGAAGAATCATCTTGG + Intronic
1107120806 13:36794094-36794116 CACTGGAAGAAGAACTGTCTCGG - Intergenic
1107204086 13:37760769-37760791 CATTGGAAGAAGAATGTCTTGGG - Intronic
1107694583 13:42987632-42987654 CATGGGAAGAAGAATCGTCTTGG - Intronic
1107843020 13:44479385-44479407 CGCTGGAAGAAGAATTGTCTTGG - Intronic
1108557248 13:51605898-51605920 CAATGAAAGACGAATTGTCCTGG - Intronic
1108675639 13:52735603-52735625 CAATGGAAGAAGAATTGTCTTGG + Intronic
1109257534 13:60101579-60101601 CATTGGAAGAAGACTTGTCTTGG - Intronic
1109584913 13:64386964-64386986 CATTGGAAGAAAAATTGTCTTGG + Intergenic
1109691792 13:65903621-65903643 CATTGAAAGAAGTATTGTCTTGG - Intergenic
1109744314 13:66602132-66602154 CATTGGAAGAAGAATTGTCTTGG + Intronic
1109872233 13:68347580-68347602 CAATGGAAGAAGAATAGTCTTGG - Intergenic
1109890844 13:68612382-68612404 CATGAGAAGAAGAATTGTCTTGG + Intergenic
1110133612 13:72037899-72037921 TGTTGGAAGAAAAATTGTCTTGG + Intergenic
1110253428 13:73405894-73405916 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1110430102 13:75413554-75413576 CATTGGAAGAAGAATTGTCTTGG - Intronic
1110828892 13:80007089-80007111 TTTTGGAAGAAAAATTGTTTTGG + Intergenic
1111176960 13:84607498-84607520 CACTGGAAGAATAATTGACTTGG - Intergenic
1111191516 13:84813620-84813642 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1111520101 13:89390266-89390288 TATTGGAAGAAGAATTGTCTTGG - Intergenic
1111665015 13:91256132-91256154 CTTTGGAAAAATAATTGTCTTGG - Intergenic
1111807063 13:93051003-93051025 CATTGGCAAAAGAATTGTTTAGG - Intergenic
1112429479 13:99337937-99337959 CATTGGAAGAAGAATTGTCTTGG + Intronic
1112463305 13:99621812-99621834 CACTGGAAGAAGAATTGTCTTGG - Intronic
1112469338 13:99673560-99673582 CTTTTGAGGAAGAATGGTCTAGG + Intronic
1112661492 13:101514179-101514201 CATTGTATGAAGAAGTGTGTTGG + Intronic
1112749232 13:102565336-102565358 CATTGGAGGAAGAATGCTGTGGG - Intergenic
1113169227 13:107480518-107480540 CAGTGAAAGAAGAATTGTCTTGG + Intronic
1113354325 13:109563913-109563935 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1113456365 13:110451797-110451819 CATTGGAAGAAGAATTGTCTTGG - Intronic
1113477956 13:110598789-110598811 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1113602733 13:111582070-111582092 CACTGGAAGAAGAATTGCCTAGG + Intergenic
1113877412 13:113602910-113602932 CATTGGAAGAAGAATTGTCTTGG + Intronic
1113912794 13:113852239-113852261 CATTGGAAGAAGAACTGTCTTGG - Intronic
1113921323 13:113914570-113914592 CAGTGGAAGAAGCATTGATTAGG + Intergenic
1114138316 14:19880118-19880140 CATTGGAAGAAGAATTGTGTTGG - Intergenic
1114261022 14:21036369-21036391 CATTGGAAGAAGAATTGTCTTGG + Intronic
1114514578 14:23289923-23289945 CGTTGGAAGAAGAATTGTCTTGG - Intronic
1115199520 14:30837919-30837941 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1115273930 14:31585172-31585194 CATTGGAAGAAGAATTGTCTTGG + Intronic
1115400919 14:32958956-32958978 CATTGAAAGAAGAATTGTCTTGG + Intronic
1115549654 14:34493636-34493658 CATTTGAAGAATATTTGTCTTGG - Intergenic
1115710680 14:36047546-36047568 CACAGGAAGACTAATTGTCTTGG + Intergenic
1115717837 14:36125412-36125434 CATTTGAAGAAGAATTGTCTTGG - Intergenic
1115749026 14:36469597-36469619 CATAGGAAGAAGAATTGTCTTGG - Intergenic
1116154248 14:41183737-41183759 CTTTGGAAGTGGAATTTTCTCGG - Intergenic
1116167565 14:41352589-41352611 CATTGGAAGAAAAATTGTCTTGG - Intergenic
1116331940 14:43608138-43608160 CATTGGAACAAGAATTGTCTTGG + Intergenic
1116660273 14:47701240-47701262 CACTGAAAGAAGAACTGTCTTGG + Intergenic
1117117813 14:52534458-52534480 CATCGGAAGAAGAATTGTCTTGG - Intronic
1117150492 14:52882864-52882886 CATTGGAAGAACACATGTCAGGG - Intronic
1117177082 14:53155760-53155782 CGGAAGAAGAAGAATTGTCTTGG + Intergenic
1117235891 14:53774217-53774239 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1117354457 14:54910577-54910599 CATTACCAGAAGAAGTGTCTAGG + Intergenic
1117695437 14:58357670-58357692 CAATGGAAGAAGAATTGTCTTGG - Intronic
1117804626 14:59478848-59478870 CACTGGGAGAAGAATTGTCTTGG + Intronic
1117939798 14:60950654-60950676 CAGTGGAAGAAAAATTGTCTCGG - Intronic
1117962948 14:61180444-61180466 CACTGGAAGAAGATTCGTCTTGG + Intergenic
1117979781 14:61330889-61330911 CGTTGGAAGAAGAATTGTTTTGG + Intronic
1118237368 14:64020268-64020290 TATTGGAAGAAGAATTGTCTTGG + Intronic
1118417804 14:65562090-65562112 CACTGGAAGAAAAATTGTCTTGG - Intronic
1118419013 14:65578608-65578630 TAGAAGAAGAAGAATTGTCTTGG - Intronic
1118564408 14:67123858-67123880 CATCAGAAGAAGAATTGTCTTGG - Intronic
1118582736 14:67319544-67319566 CATTAGAAGAAGAATAGTCTGGG + Intronic
1118862946 14:69679638-69679660 CATTGAAAGAAGAATTGTTTTGG - Intronic
1118898566 14:69967518-69967540 CACTGGAAGAAGAACTGTCTTGG - Intronic
1118963514 14:70557813-70557835 CACTAGAAGAAAAATTATCTTGG - Intergenic
1118965952 14:70585609-70585631 CATTGGAAGAAGAATTGTCTTGG - Intronic
1119114567 14:72007622-72007644 CATAGGAAGAAGAACTGTCTTGG - Intronic
1119151973 14:72368972-72368994 CACTGGAAGAAGAATTCTCTTGG + Intronic
1119343423 14:73900897-73900919 CACTGAAAGAAGAAATGTCTTGG - Intronic
1119574703 14:75708908-75708930 CATTGGAAGAAGAATTGTCTTGG + Intronic
1119661812 14:76457504-76457526 ACATTGAAGAAGAATTGTCTTGG - Intronic
1120049455 14:79848504-79848526 CAGTGGAAGAAGAATTGTCTTGG - Intronic
1120114720 14:80601380-80601402 CACTGGAAGAAGAATTTTCGTGG + Intronic
1120172884 14:81263635-81263657 CATAGGAAGAAGAATTGTCTTGG - Intronic
1120983457 14:90311707-90311729 CACTGGATGAAGAACTGTCTTGG + Intronic
1121037703 14:90720083-90720105 CATTGGAAGAAGAATTGTCTTGG - Intronic
1121185101 14:91960307-91960329 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1121922176 14:97892361-97892383 CATTGGAAGAAGAATTGTCTGGG - Intergenic
1122007532 14:98717824-98717846 CATTTGAAGAGACATTGTCTCGG + Intergenic
1122171371 14:99878111-99878133 CATTGGAAGAAGAATTGTCTTGG - Intronic
1122285319 14:100648349-100648371 CATTGGAAGAAGAACTGTTTTGG + Intergenic
1202939599 14_KI270725v1_random:135095-135117 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1123393540 15:19900802-19900824 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1123402449 15:20001717-20001739 CATTGAAAGAACAATTGACTTGG - Intergenic
1123466067 15:20516879-20516901 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1123479074 15:20614420-20614442 CACTGGAAGAAGAACTGTCTTGG + Intergenic
1123511788 15:21008379-21008401 CATTGAAAGAACAATTGACTTGG - Intergenic
1123638938 15:22385965-22385987 CACTGGAAGAAGAACTGTCTTGG - Intergenic
1123652047 15:22484160-22484182 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1123742467 15:23293020-23293042 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1123760858 15:23431466-23431488 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1123937505 15:25201143-25201165 AATGGGAGGAAGAATTGTGTTGG + Intergenic
1124276791 15:28332855-28332877 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1124305909 15:28578751-28578773 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1124390533 15:29251807-29251829 CGTTAGAAGAAGCATTGTCTTGG - Intronic
1124485542 15:30111767-30111789 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1124518034 15:30385500-30385522 CACTGGAAGAAGAATTGTCTTGG - Intronic
1124530369 15:30500309-30500331 CATTAGAAGAAGAATTGTCTTGG - Intergenic
1124540619 15:30580753-30580775 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1124758034 15:32426828-32426850 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1124768289 15:32507379-32507401 CATTAGAAGAAGAATTGTCTTGG + Intergenic
1125060516 15:35416077-35416099 CACTGGAAGAAGAATTGTCTTGG + Intronic
1125453417 15:39832587-39832609 GACTGGAAGAAAAATTGTCTTGG + Intronic
1125468510 15:39978643-39978665 CACTGGTAGAAGAATTGTCTTGG + Intronic
1126140892 15:45437699-45437721 CGTTGGAAGAAGAATTTTCTTGG + Intronic
1126228447 15:46297702-46297724 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1126619227 15:50620368-50620390 CATTGGAAGAAAAATTGTCTTGG - Intronic
1126790860 15:52219953-52219975 TATTGGAAGAAGAATTGTCTTGG + Intronic
1126830033 15:52592596-52592618 CACTGGTAGAAGAATTGTCTTGG + Intronic
1126830425 15:52597767-52597789 CACTGGAAGAAGAATTGTCTTGG + Intronic
1127061385 15:55189665-55189687 CATTGGAAGAAGAATTGTCTTGG - Intronic
1127218387 15:56849437-56849459 CATAGGAAGAAGAATTGTCTTGG - Intronic
1127246955 15:57187445-57187467 CATTAGAAGAATTATTGTCTTGG + Intronic
1127319765 15:57831657-57831679 CATTGAAAGAAGAATTGTCTTGG - Intergenic
1127361947 15:58252076-58252098 CGACGGAAGAAGAATTGTCTTGG + Intronic
1127387745 15:58480777-58480799 CATTGGAAGAAGAATTGTCTTGG - Intronic
1127656485 15:61060780-61060802 CACTGGAAGAAGAATTGTCTTGG + Intronic
1128439363 15:67690074-67690096 CATTGGAAGAAGAACTGTCTTGG - Intronic
1128856404 15:71020979-71021001 CATTGGAAGAAGAATTGCCTTGG + Intronic
1128891149 15:71332952-71332974 CACTGGAATAAGAATTGTCTGGG - Intronic
1129117496 15:73373231-73373253 TGGAGGAAGAAGAATTGTCTTGG - Intergenic
1129131961 15:73507417-73507439 CCTTGGAAGAAGAATTGTCTTGG - Intronic
1129282428 15:74496284-74496306 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1129499337 15:76020539-76020561 CAGTGGAAAAATAATTGTCTTGG + Intronic
1129876031 15:78976323-78976345 CATTGGAAGAAGAATTGTCTTGG + Intronic
1130078080 15:80707499-80707521 CATTGGAAGAAGAATTGTCTTGG + Intronic
1130109820 15:80954899-80954921 CATTGGAAGGAGAATTGTCTTGG - Intronic
1130181245 15:81630960-81630982 CATAAGAAGAAGGATAGTCTTGG + Intergenic
1130247577 15:82266070-82266092 CATTGGAAGAAGAATTGTCTTGG + Intronic
1130366003 15:83239424-83239446 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1130371645 15:83289671-83289693 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1130372631 15:83298679-83298701 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1130435919 15:83899656-83899678 CAGTGGAAGCAAAATTGCCTTGG + Exonic
1130452571 15:84071435-84071457 CACTGGAAGAAGACTTGTCTTGG - Intergenic
1130521134 15:84661399-84661421 CATTGGAAGAGGAATTGTCTTGG + Intergenic
1131079094 15:89519461-89519483 CATGGGAAGAAGAGGTGTCTTGG - Intergenic
1131516561 15:93081583-93081605 TCTTGGGAGAAGAACTGTCTTGG + Intronic
1132280961 15:100614677-100614699 CACTGGAAGAAGAATTGTCTTGG + Intronic
1132416568 15:101624444-101624466 CATTGGAGATAGAATTGTCTTGG + Intronic
1133435157 16:5772910-5772932 CATTGGAGGAAGAATGTTATGGG + Intergenic
1134085628 16:11355647-11355669 CTTTGAAGGATGAATTGTCTCGG - Intergenic
1134157097 16:11852469-11852491 CACTGGAAGAAGAATTGCCTGGG + Intergenic
1134268825 16:12715912-12715934 CTTTACAAGAAGAATTGTCTTGG - Intronic
1134432355 16:14222482-14222504 CACTGGAAGAAGAATTGTTTTGG - Intronic
1134643135 16:15845359-15845381 CAGAAAAAGAAGAATTGTCTTGG - Intronic
1135043814 16:19138095-19138117 CACTGGAAGAAGAATTGTCTTGG - Intronic
1135106555 16:19654839-19654861 CATGGGAAGAAGAAAGATCTAGG - Intronic
1135183709 16:20296819-20296841 CAGTGGAAGAAGAATTGTCTTGG - Intergenic
1135234681 16:20744190-20744212 CCTTGGAAGAAGAATCCTCTTGG - Intronic
1135256329 16:20944437-20944459 CACTGGATGAAGAACTGCCTGGG + Intronic
1135542492 16:23342598-23342620 CATTGGAAGAAGAATTATCTTGG + Intronic
1135780119 16:25292788-25292810 CATCAGAAGAAGAATTGTCTTGG - Intergenic
1136426595 16:30172035-30172057 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1136653647 16:31695422-31695444 TGTTGGAAGAAGAATTGTCTTGG + Intergenic
1136696029 16:32083016-32083038 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1136699543 16:32118172-32118194 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1136715831 16:32280350-32280372 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1136752082 16:32649414-32649436 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1136768115 16:32809752-32809774 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1136771374 16:32844728-32844750 CATTGGAAGAAGAATTCTCCTGG - Intergenic
1136796523 16:33026270-33026292 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1136800034 16:33061347-33061369 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1136822509 16:33331052-33331074 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1136829072 16:33387591-33387613 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1136834138 16:33486373-33486395 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1136899205 16:34016718-34016740 CATTGGAAGAAGAATTCTCCTGG + Intergenic
1136902431 16:34052614-34052636 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1136957931 16:34805354-34805376 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1136985116 16:35095828-35095850 AATTAGAAGAAGAATTGTCTTGG - Intergenic
1136985735 16:35102532-35102554 CACTGAAAGAAGCATTTTCTTGG + Intergenic
1137083977 16:36099897-36099919 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1137242961 16:46674001-46674023 CACTGGAAGAAGCATTTTCTTGG - Intronic
1137656861 16:50167150-50167172 TAGAAGAAGAAGAATTGTCTTGG + Intronic
1137931611 16:52593221-52593243 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1137942153 16:52698819-52698841 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1138003140 16:53303254-53303276 CATTGTAAGAGGAATTGTATTGG - Intronic
1138029081 16:53545361-53545383 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1138030657 16:53557068-53557090 CATTGGAAGAAGAATTGTCCTGG + Intergenic
1138119065 16:54383716-54383738 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1138164363 16:54786488-54786510 CATTGAAAAAAGAATTGTCTTGG + Intergenic
1138323965 16:56145414-56145436 TAGAAGAAGAAGAATTGTCTTGG - Intergenic
1138355509 16:56375230-56375252 CATTGGAAGAAGAATTGTCTTGG - Intronic
1139047561 16:63081174-63081196 CATTGCAAGAAGAATTGTCTTGG + Intergenic
1139082589 16:63541256-63541278 CAATGGAAGAACAATTGTCTTGG - Intergenic
1139332475 16:66204072-66204094 TGGAGGAAGAAGAATTGTCTTGG + Intergenic
1140144659 16:72294885-72294907 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1140788552 16:78367473-78367495 CACTGGACAAAGAATTATCTTGG - Intronic
1141244102 16:82290405-82290427 AACTGGAAGAAAAGTTGTCTAGG + Intergenic
1141384687 16:83609289-83609311 TACTGGAAGAAGAATTGTCTTGG - Intronic
1141401984 16:83756611-83756633 CATTGGAAGAAGAATTGTCTTGG - Intronic
1141491431 16:84376594-84376616 CATTGGAAGAAGAATTGTCTTGG - Intronic
1141561983 16:84875483-84875505 CACTGGAAAAAGAATTGTCTTGG - Intronic
1141717988 16:85738018-85738040 CACTGGAAGAAGAATTGTCTTGG - Intronic
1141942609 16:87287936-87287958 CATTGGAAGAAGAATTGTCTTGG - Intronic
1142017560 16:87758613-87758635 CAATGGAAGAAGAATTGTCTCGG + Intronic
1142024995 16:87807618-87807640 CCCTGGAAGAAGAATTGTCTTGG + Intergenic
1142318403 16:89364595-89364617 CACTGGAAGAAGAACTGGCTTGG + Intronic
1203010778 16_KI270728v1_random:238147-238169 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1203054223 16_KI270728v1_random:909401-909423 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1203070505 16_KI270728v1_random:1071772-1071794 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1203073798 16_KI270728v1_random:1106838-1106860 CATTGGAAGAAGAATTCTCCTGG - Intergenic
1142584958 17:966672-966694 CGTTGGAAGAAGAATTGTCTTGG - Intronic
1142718420 17:1760818-1760840 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1142986952 17:3701291-3701313 CATTGGAAAAAGAATTGTCTTGG - Intergenic
1143069454 17:4278368-4278390 CACTGGAAGACAAATTGTCTTGG + Intronic
1144033359 17:11341924-11341946 CAGTGGGAGAAGAGGTGTCTGGG + Intronic
1144347510 17:14362855-14362877 CATTAGAAGAAGAATTGTCTTGG - Intergenic
1144420591 17:15094362-15094384 CATTGGAAGAAGGATGGTCTTGG + Intergenic
1144463587 17:15478568-15478590 CACTGGAAGAAGAATTGTCTTGG + Intronic
1144606316 17:16668170-16668192 CATTGAAAAATGAATTGCCTAGG - Intergenic
1145234197 17:21197332-21197354 CATTGGAAAAAGAATTGTCTTGG - Exonic
1145285056 17:21499492-21499514 CAATGGAAGAAGAATTGTCTTGG - Intergenic
1145392467 17:22466255-22466277 CATTGGAAGGAGAATTGTCTTGG + Intergenic
1145690452 17:26733201-26733223 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1145710225 17:26964358-26964380 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1145741351 17:27277361-27277383 CGTTGGAAGAAGAATGGTCTTGG + Intergenic
1145766955 17:27464874-27464896 CATTGGAAGAAGAATGCTCCTGG + Intronic
1146017283 17:29244207-29244229 CATTAGAAGAATAATTATCTTGG - Intergenic
1146056993 17:29586383-29586405 CATTGGAAGAAGAATTTTCTTGG - Intronic
1146724169 17:35144081-35144103 CAGTGGAAAAAGAATTGCCTTGG - Intergenic
1147011221 17:37450014-37450036 CACTGGAAGAAGAAGTGTCCTGG + Intronic
1147048516 17:37772805-37772827 CATTGGAATAAAAATTGTTTTGG + Intergenic
1147505288 17:41010306-41010328 CATTGAAAGAAGAATTGTCTTGG - Intronic
1147560155 17:41503792-41503814 CATTGGAAGAAGAATTGTCTTGG + Intronic
1147712111 17:42475576-42475598 CATTGGAAGAAGAACTGTCTTGG - Intronic
1148264168 17:46211325-46211347 CACTGGAAGAAGAGCTGTCTTGG + Intronic
1148815331 17:50323912-50323934 CATTGGAAGAAGAATTATCTTGG - Intergenic
1148932496 17:51138409-51138431 CATTAAAAGAAGAATTGTCTTGG + Intergenic
1148949100 17:51293561-51293583 CAACGGAAGAAGAATTGTCTTGG - Intronic
1149113681 17:53064560-53064582 CATTGGAATAAAAATTGTCTTGG + Intergenic
1149333686 17:55612074-55612096 CACTGGGAGAAGAATTGTCATGG - Intergenic
1149711734 17:58749311-58749333 CATTGGAAGAAGAATTGCCTTGG - Intergenic
1150179227 17:63097500-63097522 CATTGGAATAAGTATTGTCTTGG + Intronic
1150272682 17:63876737-63876759 CATTGGAAGAAGGATGGTGAGGG - Intronic
1150704106 17:67472265-67472287 CATTGGAAGAAGAATTGTCTTGG + Intronic
1150807359 17:68329747-68329769 TGTTGGAAGAAGAATTGTCTTGG + Intronic
1150909493 17:69373140-69373162 CAATGATAGAAGAATTCTCTAGG + Intergenic
1151045276 17:70912697-70912719 CATGGGAAGAAGAATTGTCTTGG - Intergenic
1151648963 17:75453896-75453918 TGTTGGAAGAAGAATTGTCTTGG - Intronic
1152210821 17:79002199-79002221 CATTGGAAGAAGAATTGTCTTGG - Intronic
1153038228 18:785211-785233 TATTGGAATAAGAATTATCTTGG - Intronic
1153141274 18:1975076-1975098 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1153407279 18:4754931-4754953 CATTGGAAAAAGAATTGTCTTGG - Intergenic
1153662324 18:7336066-7336088 CACTGGGAGAGGAATTGTCCCGG + Intergenic
1153692196 18:7605115-7605137 TGTTGGAAGAAGAGCTGTCTTGG + Intronic
1153937844 18:9946534-9946556 CACTGGAAGAAAAATTGTCTTGG - Intronic
1153993005 18:10416617-10416639 CATTGGAAGATGAATTGTCTTGG + Intergenic
1154436736 18:14349424-14349446 CAATGGAAGAATAATTTTCTTGG + Intergenic
1154518024 18:15196278-15196300 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1155037866 18:22040455-22040477 CAATGGAAGAAGAATTGTCTTGG - Intergenic
1155068588 18:22291913-22291935 CACTGGAAGAAGAATTATCTTGG - Intergenic
1155413115 18:25567753-25567775 CATTGGAAGAAGAACTGTCTCGG - Intergenic
1155613326 18:27693816-27693838 CATTGGAAGAAGAGTATTCTTGG - Intergenic
1155676544 18:28436178-28436200 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1155715650 18:28940298-28940320 CACTGGAAGAAGAATTGCCTTGG + Intergenic
1155794146 18:30012646-30012668 TATTTGAAGAAGCAGTGTCTAGG + Intergenic
1155847233 18:30723300-30723322 CATGGGAAGAAGGAAGGTCTAGG + Intergenic
1155905073 18:31440833-31440855 CATTGGAAGAAGTATTGTCTTGG - Intergenic
1156682659 18:39609722-39609744 CATTGGAAGAAGAATTGTCTGGG - Intergenic
1156703874 18:39856794-39856816 CATTGGAAGAAGAACTGTCTTGG - Intergenic
1156722310 18:40085076-40085098 CACTGGAGGAAGCATTGTCTTGG - Intergenic
1156879731 18:42062505-42062527 CAGTGGAAGAAGAATTGTCTTGG - Intronic
1157056907 18:44240378-44240400 TATTGGTAAAAGAATTGTCTTGG + Intergenic
1157363726 18:47044140-47044162 CAGTGGAAGAAGAATTCCCTTGG + Intronic
1158019973 18:52830339-52830361 CACTAGAAGAAGAATTGTCTTGG - Intronic
1158734636 18:60065697-60065719 CATTGGAAGAAGAATTGTATTGG + Intergenic
1159366190 18:67468436-67468458 TATGGGAAGAAGAATTGGCATGG + Intergenic
1159399304 18:67909990-67910012 CATTGAAAGAATAATTATCTTGG + Intergenic
1159440953 18:68479306-68479328 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1159449186 18:68577944-68577966 CACTGGAAGAAGAATCATCTTGG + Intergenic
1159508734 18:69368331-69368353 TATTGGAAGAAGAATTATCTTGG + Intergenic
1159869760 18:73747101-73747123 CACTAGAGGAAGAATTGTCTTGG - Intergenic
1159882837 18:73875653-73875675 AATTGGAATAAGAATCTTCTGGG - Intergenic
1160378008 18:78428813-78428835 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1160618454 18:80151767-80151789 CAGTGGAAGAAGAATTGTCTTGG + Intronic
1161549790 19:4905842-4905864 CATTGGAAGAAGAATTGTCTTGG - Intronic
1162638110 19:11986212-11986234 CACTGAAAGAAGAATTGTCTTGG + Intergenic
1162901501 19:13797554-13797576 CACTGGAAGAAGAACTGTCTTGG + Intronic
1163101470 19:15099688-15099710 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1163326630 19:16607784-16607806 CATTGGAAGAAGGATTGTCTTGG - Intronic
1163658643 19:18563116-18563138 CATTGGAAGAAGAATTGTCTTGG - Intronic
1165067248 19:33236473-33236495 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1165188941 19:34046038-34046060 CATTGAAAGAACAATTGTCTTGG + Intergenic
1165256922 19:34582536-34582558 CACTGGAAGAAGGATTGTTTTGG + Intergenic
1165262420 19:34631378-34631400 CAGTGGAAGAAGAATAGTCTTGG - Intronic
1165282395 19:34808451-34808473 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1165396448 19:35566783-35566805 CATTGGAAGAAGAATTGTCCTGG - Intergenic
1165694303 19:37888898-37888920 CTTTGGAGGAAGAAGTGTCTCGG - Exonic
1166019889 19:40017690-40017712 CACTGGAAGAAGAATTATCTTGG - Intergenic
1166200830 19:41237002-41237024 CAGTGGAAGAAGAATTGTCTTGG - Intronic
1166615549 19:44241727-44241749 CACTAGAAGAATAATTGTCTTGG - Intronic
1166663246 19:44661221-44661243 CATGGGAAGAAGACATGCCTGGG - Intronic
1166953424 19:46445718-46445740 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1167820488 19:51923165-51923187 CACTGGAAGAAGAATTGTCTTGG - Intronic
1167833265 19:52044947-52044969 CACTGGAAGAAGAAATGCGTTGG + Intronic
1167964276 19:53131135-53131157 CATTGGAAGAAGAATTGTCTTGG - Intronic
1168705675 19:58469084-58469106 CATTGGAAGAAGAATTGTCTTGG - Intronic
1202670102 1_KI270709v1_random:41866-41888 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1202679925 1_KI270712v1_random:1203-1225 CATTGGAAGAAGAATGCTCCTGG - Intergenic
925145128 2:1576906-1576928 CATTGGAAGAAGAATTGTCTTGG - Intergenic
925331407 2:3061603-3061625 CAAATGAAGAAGAATTGTGTTGG + Intergenic
925402960 2:3588802-3588824 CATTGGAAGAAGAATTGCCTTGG - Intergenic
925524243 2:4782182-4782204 CCTTGGAAGAAGCTTTATCTAGG + Intergenic
925558857 2:5165813-5165835 CACTGGAAAAAGAATTGTCTTGG + Intergenic
925571887 2:5321277-5321299 CACTGGAAGAAGAAGTGTCTTGG + Intergenic
925593524 2:5533144-5533166 CATTGTAAGAAGAATTGCCTTGG + Intergenic
925642759 2:6002731-6002753 CACAAGAAGAAAAATTGTCTTGG + Intergenic
925673966 2:6340374-6340396 CGCTGGAAGAAGAATTGCCTTGG - Intergenic
925750175 2:7082607-7082629 GATTGGAAGAAGAATTGTCTTGG + Intergenic
925827735 2:7866477-7866499 CACTGGGAGAACGATTGTCTTGG - Intergenic
925930643 2:8705176-8705198 CACTGAAAGAAGAATTGTCTTGG - Intergenic
926314462 2:11699146-11699168 CATTGGAAGAAGAATTGTCTTGG - Intronic
926415169 2:12642609-12642631 CTGTGGCAGAAGAATAGTCTCGG + Intergenic
926421791 2:12707173-12707195 CACTGGGAAACGAATTGTCTTGG + Intergenic
926630955 2:15135802-15135824 CACTGGAAAAAGAATTGTCTTGG + Intergenic
926690207 2:15727864-15727886 CGTTGGAAGAAGAATTGTCTTGG + Intronic
926722888 2:15975276-15975298 CATTGGGAGAGGAATTGTCTTGG - Intergenic
926766737 2:16328795-16328817 CATTGGAAGAAGAATTGTCCTGG + Intergenic
926876356 2:17484037-17484059 CACTGGAAGAAGAATTGTCTTGG - Intergenic
927283809 2:21335808-21335830 CATTGGAAGAAGAATTGTCTTGG + Intergenic
927317874 2:21706655-21706677 CACTGGAGGAAGAATTGTCTTGG + Intergenic
927549155 2:23981952-23981974 CATTGGAAGAAGAATGGTCTTGG + Intronic
927584580 2:24289842-24289864 CATTGGAAGAAGAGTTGTCTTGG - Intronic
927873816 2:26641115-26641137 CATTGGAAGAAGAATTGTCTTGG - Intronic
927924070 2:26997416-26997438 CACGGGAAGAAGAATTGTCTTGG - Intronic
927993290 2:27463593-27463615 CATCGGAAGAAGAATTATCTTGG - Intronic
928284934 2:29981895-29981917 CACTGGGAGAAGAATTGTCTTGG - Intergenic
928957495 2:36885424-36885446 CATAGGGAGATGATTTGTCTTGG - Intronic
929279407 2:40061696-40061718 TACAGGACGAAGAATTGTCTTGG - Intergenic
929352311 2:40972215-40972237 CGCTGGAAGAAAAATTATCTTGG + Intergenic
929389564 2:41454181-41454203 CACTGGAAGAAGAATTGTCTTGG - Intergenic
929655780 2:43730323-43730345 CACTGGAAGAAGAATTGTCTTGG - Intronic
929858541 2:45655411-45655433 CATCGGAAGAAGAATTGTCTTGG - Intronic
930219159 2:48728147-48728169 CACTGGAAAAAGAATTGTCTTGG - Intronic
930356554 2:50328272-50328294 CATTGGAAGAAGAATTGTCTTGG - Intronic
930383578 2:50662646-50662668 CATTGGAAGAAGAATCGCCTTGG - Intronic
930412870 2:51048665-51048687 CCCTGGAAGAAGAATTGTCTTGG - Intergenic
930416204 2:51093866-51093888 CATTGGAGGAAGATATGCCTGGG + Intergenic
930614052 2:53574832-53574854 CACTGGAGGAAGAATTATCTTGG + Intronic
930702322 2:54471006-54471028 CACTGGAAGAAGAAGTGTCTTGG - Intronic
931171587 2:59809107-59809129 CAGAAGAAGAAGAATTGTTTTGG - Intergenic
931177255 2:59866325-59866347 CGCTGGAAGAAGAATGGTCTCGG + Intergenic
931331671 2:61292517-61292539 CACTGGAAGAACAACTGTCTTGG + Intronic
931393578 2:61865801-61865823 CGTTGGAAGAAGAATTCTCTTGG - Intergenic
931438085 2:62266276-62266298 CATTAGAAGAAGAATTGCCTTGG + Intergenic
931488678 2:62720765-62720787 CACTGGAAGAAGAATTGTCTTGG + Intronic
931572755 2:63687011-63687033 CATCAGAAGAAGAATTGTCTTGG + Intronic
931690676 2:64832318-64832340 CATTGGAAGAAAAGTTATCTTGG - Intergenic
931739817 2:65231792-65231814 CATTGGAAGAGGAATTGTCTTGG + Intronic
931820468 2:65946446-65946468 CATTGGAAGAAGAATTGTCTTGG + Intergenic
932134476 2:69216243-69216265 CATTGAAAGAAGAAGTTTTTTGG - Intronic
932682866 2:73841633-73841655 CACTGGAAGAAGAACTGTCTTGG - Intronic
932720602 2:74136518-74136540 CAATGGAAGAAGAATTCTCTTGG - Intronic
933012140 2:77079578-77079600 AAATGGAAGAAGAATGGTCTTGG - Intronic
933112125 2:78416179-78416201 TACTGAAAGAAGAATTGTCTCGG - Intergenic
933638232 2:84730486-84730508 CATTGGAAGAAGACTTGTCTTGG + Intronic
934109244 2:88726423-88726445 CACTGGAAGAAGAATTGTCTTGG - Intronic
934251314 2:90358543-90358565 CATTGGAAGAAGAATGCTCCTGG - Intergenic
934258245 2:91444857-91444879 CATTGGAAGAAGAATGCTCCTGG + Intergenic
934489249 2:94748084-94748106 CAATGGAAGAAGAATTTTCTTGG - Intergenic
934585196 2:95486287-95486309 CATTAGAAAAAGCGTTGTCTTGG + Intergenic
934594264 2:95590460-95590482 CATTAGAAATAGAATTGTCTTGG - Intergenic
934631038 2:95922444-95922466 GAGTGGATGAAGAAATGTCTGGG - Intronic
934788514 2:97035210-97035232 CATTAGAAAAAGCATTGTCTTGG + Intergenic
935015348 2:99176746-99176768 CATTGGAAAAATAATTGTCTTGG - Intronic
935026263 2:99279836-99279858 CACTGGAAGAAGAATTGTCTTGG - Intronic
935036163 2:99376215-99376237 CATTACAAGAAGAATTGTCTTGG - Intronic
935275514 2:101472624-101472646 CACTGTAAGAAGAATTGTCTTGG + Intronic
935744938 2:106182191-106182213 CAGTGGAAAAATAATTGTCTTGG + Intronic
935782413 2:106519716-106519738 CACTGGAAGAAGAACTGTCTTGG + Intergenic
936276042 2:111098245-111098267 CATTGGAAGAAGAGTTGTCTTGG + Intronic
936744340 2:115556424-115556446 CATTGGAAGAAGAATTGCCTTGG - Intronic
936895762 2:117425781-117425803 CATTGAAAGAATCTTTGTCTAGG + Intergenic
936921818 2:117696681-117696703 CACCAAAAGAAGAATTGTCTTGG - Intergenic
937398603 2:121561532-121561554 CACTGGAAGAAGAAATGTCTTGG + Intronic
937457932 2:122059052-122059074 CACTGGAAAAAGAATTGTCTTGG - Intergenic
937479354 2:122242617-122242639 CTTTGGAAGAGGCATTGCCTGGG - Intergenic
937517902 2:122676596-122676618 CACTGGAAGAAGAATGGTCTTGG - Intergenic
937605421 2:123794870-123794892 CACCAGAAGAAGAATTGTTTTGG - Intergenic
937827746 2:126386604-126386626 TACTGGAAAAAGAATTGTCTTGG + Intergenic
937960893 2:127457466-127457488 TGTTAGAAGAAGAATTGTCTTGG - Intronic
938157641 2:128955159-128955181 CATTGGAAGAAGAATTGTCTTGG + Intergenic
938225676 2:129614334-129614356 CACTGGAAGTAGAATTGTCTTGG - Intergenic
938517942 2:132036515-132036537 TATTGGAAGAAGAATGCTCCTGG - Intergenic
938739143 2:134214397-134214419 CATTGGAAGAAGAATTGTCTTGG + Intronic
939064516 2:137466554-137466576 CATTGGAAGAAGAATTGTCTTGG - Intronic
939201969 2:139047400-139047422 CATTGGCAGCATAATTGTATCGG - Intergenic
939354363 2:141082119-141082141 AATTAAAATAAGAATTGTCTTGG - Intronic
939387867 2:141524619-141524641 CATTGGAGGAAGAATTATCTTGG - Intronic
939427530 2:142058606-142058628 TATTGGGAGAAAAATTGTCTTGG - Intronic
939742268 2:145923415-145923437 CATTAGAAGAAGAATTGTCTTGG + Intergenic
939938500 2:148321243-148321265 CATTGGAAGAAGAATTGTCGTGG + Intronic
940024160 2:149187671-149187693 CATTAGAAGAAGAGCTATCTTGG + Intronic
940158450 2:150684229-150684251 TATCGGAAGAAGAATTGTCTTGG - Intergenic
940221675 2:151359353-151359375 CATTGGAAGAAGAATTGTCTTGG + Intronic
940265372 2:151830279-151830301 CACTGGAAGAAGAATTGTCTTGG + Intergenic
940462709 2:153987242-153987264 TGTGGGAAGAAGAATTGGCTGGG + Intronic
940522134 2:154764635-154764657 CATTGGAAGAATAATTATTTTGG + Intronic
940756951 2:157694253-157694275 CCTGGGAAGAAGAACTGTCTTGG + Intergenic
940896775 2:159088740-159088762 CATTGGAAGAAGAATTGTCTTGG - Intronic
941099889 2:161283840-161283862 CACTGGAAGAAGAATTGTCTTGG + Intergenic
941562713 2:167068896-167068918 CATTGGAAGAAGAATTGTCTTGG - Intronic
941713654 2:168741459-168741481 CTTTGAAAGAAGAGTTGTCTTGG + Intronic
941807477 2:169723631-169723653 CACTGGAAGAAGAACCGTCTTGG - Intronic
942187995 2:173443021-173443043 GATTGATAGAAGATTTGTCTGGG - Intergenic
942478499 2:176355969-176355991 CATTGGAAGAAAAATTGTCGTGG - Intergenic
942552825 2:177137433-177137455 TAGAAGAAGAAGAATTGTCTTGG + Intergenic
942670297 2:178368083-178368105 CTTTGGGAGAAGTATTGTCAGGG - Intronic
942808069 2:179958612-179958634 CATTGGAAGAAAAATTGTCTTGG - Intronic
942894497 2:181035744-181035766 CACTAAAAAAAGAATTGTCTTGG - Intronic
942901096 2:181119680-181119702 CACTGGAAGAAGAATTGTCTTGG + Intergenic
942984823 2:182127326-182127348 AATTTGAAGAAAAATTCTCTAGG - Intronic
943069933 2:183128534-183128556 CATTGGAAGAAGAATTGACTTGG + Intronic
943349575 2:186781431-186781453 CATTGAAAGAAGAATTGTCTTGG - Intergenic
943356001 2:186856674-186856696 TATTTGAAGAAGAGCTGTCTTGG + Intergenic
943448004 2:188013597-188013619 CACTGAAAGAAGAATTTTCAAGG - Intergenic
943561111 2:189463489-189463511 CATTGGAAAAAGAATTGTCTTGG + Intronic
943670283 2:190653021-190653043 CACTGGAAGAAGAATTGTCTTGG - Intronic
944037305 2:195310307-195310329 CATTGAAAGAATAATTGTTTGGG - Intergenic
944271487 2:197788563-197788585 CATTGGAAGAATAATTGTCTTGG + Intergenic
944286698 2:197958296-197958318 CATTAGAAGAAGAATTGTCTTGG + Intronic
944791732 2:203137353-203137375 CACTGGAAGAAGGACTGTCTTGG - Intronic
945311370 2:208317479-208317501 CACTGGAAGAAGAATTGTATTGG - Intronic
945537855 2:211041366-211041388 CATCAGAAGAAGAATTGTCTTGG - Intergenic
945586226 2:211667030-211667052 CATTGGAAGAAGAATTGTCTTGG + Intronic
945620307 2:212127666-212127688 CATCGAAAAAAGAATTGTCTTGG - Intronic
945730660 2:213528722-213528744 CACTGGAAGAAGAATTGTCTTGG + Intronic
945917969 2:215724661-215724683 TAGAAGAAGAAGAATTGTCTTGG - Intergenic
946012681 2:216578944-216578966 CATTGGAGGAGGACTTGTCTGGG + Intronic
946021526 2:216643600-216643622 ACTTGGAAGAAGAATTGTCGTGG + Intronic
946772865 2:223107363-223107385 CATTGTAAGAAAAATGGGCTTGG + Intronic
946783889 2:223222141-223222163 CATGGGAATAAGAACTGTCTTGG - Intergenic
947037815 2:225879410-225879432 CACTGGAAGAAGAATTGTCTTGG - Intergenic
947298616 2:228663066-228663088 CATTGGGAGAAGACTTGTCTTGG - Intergenic
947407407 2:229793905-229793927 TATTGGAAGATGAATTGTCTTGG - Intronic
947646600 2:231746466-231746488 CATTGGAAGAAGAATTATCTTGG - Intronic
948114473 2:235484164-235484186 CGTTAGAAGAAGAATTGTCTTGG + Intergenic
948522494 2:238549094-238549116 CATTGCACCAAGAAGTGTCTTGG - Intergenic
948789121 2:240368169-240368191 CATTAGAAGAAGAATTGTCTTGG + Intergenic
948953017 2:241267152-241267174 CAATGCAAGAAGAATGATCTTGG + Intronic
1169062294 20:2669959-2669981 TATTGGAAGAAGAATTGTCTTGG + Intergenic
1169169575 20:3453784-3453806 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1169311502 20:4545781-4545803 CATTGAAAGAATAATTGTCTTGG + Intergenic
1169794648 20:9448677-9448699 CATTGGAAAAAGAATTGTCTTGG - Intronic
1169892529 20:10468972-10468994 CACTGGAAGAAGAATTGTCTTGG + Intronic
1170063779 20:12288437-12288459 CGTTGGAAGAAGAATTGTCTCGG + Intergenic
1170903082 20:20485117-20485139 CATTGGAAAAAGAATTATCTTGG - Intronic
1170991864 20:21309590-21309612 CTTTGGAAGAAGAATTGTCTTGG - Intronic
1171181739 20:23096008-23096030 CACTGGAAGAAGAATTATCTTGG - Intergenic
1171723933 20:28597374-28597396 CAATGGAAGGAGAATTGTCTTGG - Intergenic
1172087296 20:32396917-32396939 CATTAGAAGAAGAATTGTCTTGG + Intronic
1172238162 20:33392528-33392550 AAGAAGAAGAAGAATTGTCTTGG - Intronic
1172312744 20:33931009-33931031 CATTGGAAGAAGAATAGTCTTGG - Intergenic
1172534532 20:35663357-35663379 CTTAGCAACAAGAATTGTCTGGG - Intronic
1172823340 20:37758514-37758536 CAGTGGAAACAGAATTGTGTTGG - Intronic
1173577263 20:44120672-44120694 CAGAAGAAGAAGAATTGTCATGG + Intronic
1174610754 20:51796511-51796533 CATTGGAAGAAGGATTATCTTGG - Intronic
1175433526 20:58925974-58925996 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1175516031 20:59570754-59570776 CATTGGAAGAAGAATGGTCTTGG - Intergenic
1175563382 20:59952508-59952530 TACTGGAAGAATAATTGTCTTGG + Intergenic
1175672465 20:60917204-60917226 TGGAGGAAGAAGAATTGTCTTGG + Intergenic
1175751114 20:61498694-61498716 CATTGGAAGAGGAATTGTCTTGG + Intronic
1175865772 20:62175537-62175559 CATATGAAGGAGAATGGTCTGGG + Intronic
1176417476 21:6485738-6485760 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1176583590 21:8551994-8552016 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1176728935 21:10470144-10470166 CATTGAAAGAAGAATCGTCTTGG - Intergenic
1176732207 21:10510810-10510832 CATTGGAAGAAGCATTGTCTTGG + Intergenic
1176840302 21:13836230-13836252 CAACGGAAGAATAATTTTCTTGG - Intergenic
1177104106 21:16933289-16933311 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1177215372 21:18121224-18121246 CAGTGGAAGAAGAACTGTCTTGG + Intronic
1177394298 21:20512695-20512717 CATTGGAAGAAGAACTGTGTTGG + Intergenic
1177412442 21:20747672-20747694 TATTAGAAGCAGAATTGCCTAGG - Intergenic
1177777956 21:25590317-25590339 CACTGGAAGAAGAATTGTCCTGG + Intronic
1178385964 21:32150798-32150820 CATTGGAAGAAGTATTGTCTTGG + Intergenic
1178511055 21:33205479-33205501 CACTGGAAGAAGAAATGTCTTGG - Intergenic
1178525872 21:33328180-33328202 CACTGGAAGAACAACTGTCTTGG - Intronic
1178608444 21:34058829-34058851 TACTGAAAGAAGAATTGTCTTGG + Intergenic
1178638411 21:34325969-34325991 CATTGGAAGAAGAATTGTTCTGG - Intergenic
1178726714 21:35058916-35058938 CAAGGGAGGAAGAATTGTCAAGG + Intronic
1178866125 21:36328843-36328865 CATTGGAAGAAGAATTGTCTTGG + Intronic
1179147092 21:38777526-38777548 CATCAGAAGAAGAATTGTCTTGG + Intergenic
1179244339 21:39617802-39617824 CATTAGAAGAAGAATTGTCTTGG - Intronic
1179336966 21:40465704-40465726 CATTGGAAGAAGAATTGTCTTGG - Intronic
1179376150 21:40851440-40851462 CATTGGAGGAAGAAATGGGTGGG - Intergenic
1179578176 21:42320775-42320797 CAGAAGAAGAAGAATTGTCTTGG - Intergenic
1179692972 21:43094071-43094093 CATTGGAAGAAGAATTGTCTTGG - Intronic
1179777516 21:43675943-43675965 TAATGGAAGAATAACTGTCTTGG - Intronic
1180266400 22:10528926-10528948 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1180297488 22:10956054-10956076 CAATGGAAGGAGAATTGTCTTGG - Intergenic
1180657834 22:17438689-17438711 CACTTGAAGAAGAATTGTTTTGG - Intronic
1180886489 22:19248376-19248398 CACTGGAAGAAGAATTGTCTTGG - Intronic
1181097451 22:20515398-20515420 TGTAGGAAGAAGAATTGTTTTGG + Intronic
1181342909 22:22197152-22197174 CAATGGAAGAAGAATTGTCTCGG - Intergenic
1181838731 22:25635150-25635172 CATTGGAAGAAGAATTGTCTTGG - Intronic
1182750150 22:32634991-32635013 TAGAAGAAGAAGAATTGTCTAGG - Intronic
1182872615 22:33662011-33662033 CACTGGAAGAAGAATTGTCTTGG + Intronic
1183992166 22:41604666-41604688 CACTGGAAGAAGAATGGTCTTGG + Intronic
1184360818 22:44017476-44017498 AATTGTAAGAGGAACTGTCTTGG - Intronic
1184624680 22:45715586-45715608 CACTGGAAGAAGAATTGTCTTGG - Intronic
1185000456 22:48242287-48242309 CCTTGGAAGAGGAATTGTCTGGG + Intergenic
1185308736 22:50140493-50140515 CGTTGCAAGAAGAATTGTCTTGG + Intronic
1203288968 22_KI270735v1_random:16245-16267 CATTGGAAGAAGAATGTTCCTGG - Intergenic
1203324741 22_KI270738v1_random:3428-3450 CATTGGAAGAAGAATGCTCCTGG - Intergenic
949091481 3:34403-34425 CACTGGATAAAGAATTGTCTTGG - Intergenic
949174195 3:1038999-1039021 CTTTGGAAGAAGTATTGTCTTGG + Intergenic
949190776 3:1245854-1245876 CAGTGGAAGAAGAATTGTCTTGG + Intronic
949273082 3:2243564-2243586 CATGGGAAGAAGAGTTGTCTTGG - Intronic
949689380 3:6617938-6617960 GATTGGAGCAAGAAGTGTCTTGG + Intergenic
949781870 3:7698651-7698673 CACTGCAACAAGAATTGTCCAGG - Intronic
949790377 3:7786022-7786044 CGCTGGAAGAAGAATTGTCTTGG - Intergenic
949791592 3:7798315-7798337 CACTGGAAGAAGAATTGTCTTGG + Intergenic
949798311 3:7875628-7875650 TATTGGAAGAATAATTGTCTTGG + Intergenic
949865803 3:8546207-8546229 CTCTGGAAGAAGAATTGTCTTGG + Intronic
949911223 3:8909777-8909799 CACTGGAAGAAGAATTGTCTTGG + Intronic
950047857 3:9961335-9961357 CACTGGAATAAGAATTGTCTTGG - Intergenic
950079668 3:10212359-10212381 CACTGGAAGAAGAATTGTCTTGG - Intronic
950237395 3:11335321-11335343 CACTGGAAGAAGAATTGTCTTGG + Intronic
950256190 3:11508275-11508297 CGTTGGAAGAATAATTACCTTGG + Intronic
950333697 3:12177368-12177390 CACTGGGAGAAGAACTGTCTTGG - Intronic
950341986 3:12255341-12255363 CATTGGAAAAAGAATTGTCTTGG + Intergenic
950567491 3:13779201-13779223 CATTGGAAAAAGAATTGTCTTGG + Intergenic
951083349 3:18479157-18479179 CACTGGAAAAAGAATTGCCTTGG - Intergenic
951113241 3:18830875-18830897 CGTTGGAAGAAGATTAGACTTGG + Intergenic
951202174 3:19887584-19887606 CACTGGAAGAAGACTTATCTTGG + Intronic
951409891 3:22350121-22350143 CATGGGAAGCAGTATTGTATTGG - Intronic
951583366 3:24189625-24189647 CATTTGAGCATGAATTGTCTAGG + Intronic
951926907 3:27917321-27917343 CATGGGAAAAAGCATGGTCTTGG + Intergenic
952757821 3:36887669-36887691 CATTGGAATAAGAATTGTCTTGG - Intronic
952759574 3:36902051-36902073 TATTGGAAGAAGAATTGTCTTGG + Intronic
952879395 3:37974101-37974123 CATTGGAAGAAGAATTGTCTTGG - Intronic
952890300 3:38035807-38035829 CACTAGAAGAAGAATTGTCTTGG + Intergenic
953056892 3:39395050-39395072 CATTGGAAGAAGAATTGTCTTGG + Intronic
953100605 3:39822520-39822542 TATTGGAAGAAGAATTGTCTTGG - Intronic
953148056 3:40297105-40297127 CATTAGAAGGAAAATTATCTTGG - Intergenic
953284297 3:41591434-41591456 CACTGGAAGAAGAATTGTCTGGG + Intronic
953313104 3:41899665-41899687 CATTGGAAGAAGAATTGTCTTGG - Intronic
953791933 3:45954285-45954307 CACTGGAAGAAGAATTGTTTTGG - Intronic
953900263 3:46836437-46836459 CACTGGAAGAAGAATTGTCTTGG + Intergenic
953923817 3:46970340-46970362 CAATGGAAGAAGAATTGTCTTGG - Intronic
954488403 3:50877008-50877030 CACTCAAAGAAGAATTGTCTTGG - Intronic
954527051 3:51281206-51281228 CATTGGAAGAAGAATTGTCTTGG + Intronic
954997213 3:54892618-54892640 CTCTGGAAAAACAATTGTCTGGG - Intronic
955109975 3:55939127-55939149 CATTAGAATTAGAATTTTCTTGG + Intronic
955176096 3:56614431-56614453 CATTTGCAGAATAATTGGCTGGG + Intronic
955197061 3:56814357-56814379 CAGTGGAAGAAGAATTGTCTTGG - Intronic
955225767 3:57059318-57059340 CACTGGAAGAAGAATTGTCTTGG + Intronic
955737607 3:62056466-62056488 CAATGGAAGAAGAATTGTCTTGG - Intronic
955759146 3:62259338-62259360 CATTGGAAGAAGAAATGTCTTGG + Intronic
956188149 3:66582134-66582156 CATTGGAAGAAGAATTGTCTTGG + Intergenic
956281759 3:67564758-67564780 TAGTGGAAGAAGAATTGTCTTGG - Intronic
956286787 3:67618945-67618967 CAATGGAACAAAAATGGTCTCGG - Intronic
956557226 3:70537442-70537464 CATGGGTAGAGGAATTGTTTGGG - Intergenic
956731685 3:72202160-72202182 AATGAGAAGAAGACTTGTCTGGG - Intergenic
956963561 3:74432321-74432343 CATTGGAAGAAGAATTGTCTTGG + Intronic
957004072 3:74923224-74923246 GATTGAAAGAAGAATGGTATTGG + Intergenic
957031800 3:75250624-75250646 CACTGGATAAAGAATTGTCTTGG - Intergenic
957614984 3:82515678-82515700 CTTTGGAAGAAGAATTGTCTTGG + Intergenic
957639814 3:82837706-82837728 TGTTGGATGAAGAATTGTGTTGG + Intergenic
957766787 3:84635491-84635513 CATTGGAAGAAGAATTCTCTTGG - Intergenic
958441999 3:94166266-94166288 CAGTGCAACAAGTATTGTCTAGG - Intergenic
958476072 3:94584727-94584749 CATTGGAAGAGGAATTGTCTTGG + Intergenic
958599512 3:96277052-96277074 CACTGGAAGAAGAACTATCTTGG + Intergenic
958700980 3:97589219-97589241 CATTAGAAGAAGAATTGTCTTGG - Intronic
958810021 3:98850251-98850273 CAGTGGAAAAAGAATTGTCTTGG + Intronic
958841511 3:99210376-99210398 CATTGGAAGAAGAATTGTCTTGG + Intergenic
959084981 3:101842652-101842674 CACTGGAAGAAGAATTGTCTTGG - Intronic
959216061 3:103451569-103451591 CATTGGAAGAAGAATTGTTTTGG + Intergenic
959475284 3:106803512-106803534 CATTGGAAGAGGAATTGTCTTGG - Intergenic
960096404 3:113694629-113694651 CACAGGAAGAAGAAATGTCTTGG + Intronic
960311514 3:116121948-116121970 TATTGGAAGAATAATTGTCTTGG - Intronic
960493429 3:118346539-118346561 CATTGCAGGAATAATTGTCTTGG + Intergenic
960604998 3:119496332-119496354 CATTGGAAGAATAATTGTCTTGG - Intergenic
960661661 3:120066947-120066969 CACTGGAAGAAGTATTATCTTGG + Intronic
960836257 3:121909866-121909888 CATTGGAAGATATATTGTCTTGG - Intronic
960881404 3:122348976-122348998 CATTGGTAGAAGAATTGTCTTGG - Intergenic
960939666 3:122925304-122925326 CATTGGAAGAAGAGTAGTCTTGG + Intronic
961400350 3:126636978-126637000 CATTGGAAGAAGAATTGTCTTGG - Intronic
961401314 3:126646543-126646565 AATTGTAAGAAGTATTTTCTGGG - Intronic
961426977 3:126856059-126856081 CACTGGAGGGAGAATTGTCTTGG + Intronic
961482681 3:127194267-127194289 CACTGGAAGAAGAATTGTCTTGG + Intronic
961747189 3:129071717-129071739 CATTGGAAGAAGAATTGTCTTGG + Intergenic
961902145 3:130223544-130223566 TGGAGGAAGAAGAATTGTCTTGG - Intergenic
962111994 3:132461336-132461358 CACTGAAAGAAGAGTTGTCTTGG + Intronic
962334566 3:134515748-134515770 GATTGGAAGAAGAATTGTTTTGG + Intronic
962545532 3:136430560-136430582 CAATGGAAGAACAATTGTCTGGG + Intronic
963024510 3:140905635-140905657 CATTGGAAGAAGAATAGTCTTGG - Intergenic
963210773 3:142687157-142687179 CATTAGAAGAAGAATTGTCTTGG + Intronic
963223552 3:142837329-142837351 CAATGGGAAAAGAATTATCTAGG + Intronic
963615023 3:147525782-147525804 TATTGGAAGAAGAATTGTCTTGG + Intergenic
963967709 3:151391523-151391545 CATTGGAAGAAGAATTGTCTTGG + Intronic
964155585 3:153581281-153581303 CACTGGAAGAAGAACTGTCTTGG + Intergenic
964396386 3:156250317-156250339 GCTTTGAAGAAGAATTGACTAGG - Intronic
964505316 3:157392554-157392576 CGGAAGAAGAAGAATTGTCTTGG + Intronic
964587064 3:158318115-158318137 CACTGGAAGAAGAATTGCCTTGG - Intronic
964608474 3:158584780-158584802 CATTGCAAGAAGAACTGTCTTGG + Intronic
964785744 3:160394247-160394269 CATTGGAGGAAGAATTGTCTTGG + Intronic
964842324 3:161007703-161007725 CACAGGAAGAAGAATTGTCTGGG - Intronic
965071066 3:163916125-163916147 TATTGAAAGAAGAATTGTCTTGG - Intergenic
965355912 3:167672716-167672738 CATTGGAAGAAGAATTTTCTTGG - Intergenic
965477548 3:169176045-169176067 CACTGGAAGAAGAATTATCTTGG + Intronic
965661584 3:171047500-171047522 CATTGGAAGAATAATTGTCTTGG + Intergenic
965723266 3:171685181-171685203 CATTGGAAGAAGAATTGTCTTGG - Intronic
965883910 3:173420727-173420749 CGGAAGAAGAAGAATTGTCTTGG - Intronic
965957854 3:174392498-174392520 CTTTGGAAGTAGAATTGTTAGGG + Intergenic
966313796 3:178623902-178623924 CATTGGAAGAATATTTGCCCAGG + Intronic
966356933 3:179090518-179090540 CATTGGAAGAAGAATTGTTGTGG - Intergenic
966402289 3:179560674-179560696 GATTGGAAGAAGAAATATTTTGG + Intergenic
966601864 3:181783685-181783707 CAATGGAAGAAGAATAGTCTTGG + Intergenic
967388759 3:188934909-188934931 CATTAGAGGAAGAATTGTCTTGG - Intergenic
967773235 3:193357718-193357740 CATTAGAAGAAGAGTTGCTTTGG + Intronic
967794574 3:193585541-193585563 CATTGGAAGAAGAATTGTCTTGG - Intronic
967964950 3:194953717-194953739 CATTGGAAGAATAGATGTCTGGG + Intergenic
968193143 3:196685432-196685454 CATTAAAAGAAGAATTGTCTTGG - Intronic
968336345 3:197916829-197916851 CACTGGAAGAAGAATTGTGTTGG + Intronic
968378032 4:60946-60968 CATTGGAAGAAGATTTGTCTTGG + Intronic
968385488 4:132852-132874 CATTGGAGGAAAAATTGTCTTGG + Intronic
968394403 4:220378-220400 CATTGGAAGCAGAATTATCTTGG + Intergenic
968406626 4:345437-345459 CATTGGAAGAAGAATTGTCTTGG + Intronic
968411419 4:394284-394306 CATTAGAAGCAGAATTGTCTTGG + Intergenic
968822089 4:2861979-2862001 CACTGGAAGAAGAATTGTCTCGG - Intronic
968995786 4:3944818-3944840 CATTGGAAGAAGAATCACCTTGG + Intergenic
969375158 4:6758475-6758497 CATTGGAAGAAGAATTGTCTTGG + Intergenic
969391626 4:6895124-6895146 CATTAAAAAAAGAATTGGCTGGG + Intergenic
969398418 4:6938119-6938141 CATGGGAAGAAGCTGTGTCTCGG - Intronic
969938567 4:10707167-10707189 CATTGGTAGAAGAATTGTCTTGG + Intergenic
970016284 4:11516187-11516209 CATTAGAAGAAGAATTGTTTTGG + Intergenic
970119805 4:12740928-12740950 CATTGGAAGAAGAACTATCTTGG + Intergenic
970261674 4:14231250-14231272 CATTGGAAGAAGAATTGTCTTGG + Intergenic
970302675 4:14697967-14697989 CACTGGAAGAAGAATTTTCTTGG - Intergenic
970480871 4:16472482-16472504 TATTGGAAGAAGAATTGTCTTGG + Intergenic
970526243 4:16935029-16935051 CATTGGAAGAAGAATTGTTTTGG - Intergenic
971283198 4:25259636-25259658 CACTGGAAGAAGAATTGTCTTGG + Intronic
971565744 4:28138602-28138624 CATTTGAAGAAGAATTTTGCTGG + Intergenic
971774425 4:30943781-30943803 CACTGGAAAAAAAATTGTCTTGG - Intronic
972055302 4:34794869-34794891 CATTGGAAGAAGAATTGACTTGG - Intergenic
972205391 4:36765909-36765931 CACTGTAAGAACAATTGTCTTGG + Intergenic
972331698 4:38069927-38069949 CAGCAGAAGAAGAATTGTCTTGG - Intronic
972402692 4:38719964-38719986 CATTGGAAGAAGAATTATCTTGG - Intergenic
972529324 4:39947545-39947567 CACTGGAAGAAGAATTGTCTTGG + Intronic
972594597 4:40518738-40518760 CACTGGAAGAAGAATTGTCTTGG + Intronic
972755010 4:42037285-42037307 TATTGGAAAAACAAGTGTCTGGG - Intronic
972761246 4:42106532-42106554 CGTCGGAAGAAGAATTGTCTTGG - Intergenic
973975946 4:56262573-56262595 CACTGGAAGAAGAACTGCCTTGG - Intronic
974310219 4:60197208-60197230 TATTGGAACAGGAATTGGCTGGG - Intergenic
974587130 4:63894075-63894097 AAGTGGAAGAAGGATTGCCTAGG + Intergenic
975269926 4:72419672-72419694 CATTGGAAGAAGAATTGTCTGGG - Intronic
975656448 4:76645831-76645853 TCTTGGAAGAAGAAGTGTTTTGG - Intronic
975671826 4:76787666-76787688 CAGTGGAAGAAAAATAGTCTTGG + Intergenic
975721139 4:77249768-77249790 CAGTGTAATAAGAATTATCTAGG + Intronic
975799463 4:78044703-78044725 AAGTGGAAGAAGAATTGTCTTGG + Intergenic
975858636 4:78652031-78652053 CATTGGAAGAAAAATTGTCTTGG - Intergenic
975997154 4:80329137-80329159 CATTGGAAGAAGAATTATCTTGG - Intronic
976035610 4:80816778-80816800 CACTGGAAGAAGAATTGTCTTGG + Intronic
976269226 4:83214074-83214096 CATTGGAAGAATAATTGTCTTGG - Intergenic
976305707 4:83557452-83557474 CATTGGAAGAAGCATTGTCTTGG + Intronic
976412407 4:84730717-84730739 TATTGGAAGAAAAATTGTCTTGG + Intronic
976697556 4:87934367-87934389 CACTGAAAGAAGAGTTGTCTTGG + Intergenic
976718787 4:88150596-88150618 CACTGGAAGAAGAATTGTCTTGG + Intronic
976773928 4:88686186-88686208 CATTGGAAGAAGAATTGCCTTGG - Intronic
976986775 4:91310323-91310345 GATTGGAAGAAGAATTGTCTTGG + Intronic
977088325 4:92634049-92634071 CATTGGAAGAAGAATTGTCTTGG + Intronic
977192544 4:94018785-94018807 CATTGAAAGAAGAATTGTCTTGG + Intergenic
977234422 4:94490490-94490512 CAGTGGAAAAAGAATTGGTTTGG + Intronic
977237941 4:94531456-94531478 CGTTGGAAGAGGAGTTGTTTTGG + Intronic
977375979 4:96204442-96204464 CATTGTAAGAATCAATGTCTGGG + Intergenic
977421019 4:96799624-96799646 CACTAGAAGAAGAATTATCTTGG - Intergenic
977549398 4:98424334-98424356 TATTGGAAAACGAATTGTCTTGG + Intronic
977613779 4:99064626-99064648 CAGTGGAAGAAGAATTATCTTGG - Intergenic
977850176 4:101817893-101817915 CATTGGAAGAAGAATTGTCTCGG - Intronic
977941794 4:102867961-102867983 CACTGGAAGAAGAATTGTCTTGG - Intronic
977956341 4:103031397-103031419 CCTTGGAAAAAGAATTGTTAAGG + Intronic
978102601 4:104860926-104860948 CATTAGAAGAAGCTTTGTCTTGG - Intergenic
978150828 4:105432775-105432797 CATTGGAAAAATAATTGTCTTGG - Intronic
978386616 4:108182106-108182128 CAGTGGAAGAAGAATTGTCTTGG - Intergenic
978455546 4:108886522-108886544 CATTGGAAGAAAAACTGTCTTGG - Intronic
978567565 4:110100234-110100256 CATTTGAGGAAGATTTCTCTGGG - Intronic
978830298 4:113076138-113076160 CATTAGAAGAATAAATGTCTTGG + Intronic
978984242 4:114989624-114989646 CACTGTATGAAGAATTGCCTGGG + Intronic
979194375 4:117902807-117902829 AAGTGGAATAGGAATTGTCTTGG + Intergenic
979277676 4:118831665-118831687 CACTGGGAGAAGAATTGTCATGG - Intronic
979642319 4:123023685-123023707 CATTGGAAGAATTATCGTCTCGG + Intronic
979655946 4:123194252-123194274 TGCTGGAAGAAGAATGGTCTTGG + Intronic
979682360 4:123475802-123475824 CATTGGAAGAAGAATTATCCTGG + Intergenic
979992919 4:127396572-127396594 CACTGGAAGAAGAATTGTATTGG + Intergenic
980256848 4:130392651-130392673 CAGTTGAAGAAGAATTGTCTTGG + Intergenic
980793079 4:137645021-137645043 CATTGGAAGACCAATTGTCTTGG - Intergenic
980930811 4:139180834-139180856 CACTGGAAGAATTATTATCTTGG - Intergenic
981067472 4:140499813-140499835 CATTGGAAGGAAAATTGTCTTGG + Intergenic
981154410 4:141417045-141417067 CGTTGAAAGAAGAGTTATCTTGG + Intergenic
981344404 4:143658761-143658783 CTTTAGAAGAAGAATTGTCTTGG - Intronic
981467004 4:145084515-145084537 CACTGGAAGAAGAACTGTCTTGG + Intronic
981638815 4:146912040-146912062 CATTGGAAGAAGAATTGCCTTGG + Intronic
981751613 4:148097813-148097835 CATTGGAAGAAGAATTGTCTTGG - Intronic
981881188 4:149614660-149614682 CATTGGAAGAAGAATTGCCTGGG + Intergenic
981919894 4:150076316-150076338 CATTGGAAGAAGAATTGTCTTGG - Intergenic
982064528 4:151641591-151641613 CACTGGAAGAATAATTGTCTTGG - Intronic
982160666 4:152565837-152565859 CATTGGAAGAAGAATTGTCTTGG - Intergenic
982474042 4:155828258-155828280 CACTGAAAGAAGAATTTTCTTGG + Intergenic
982534136 4:156587198-156587220 CGTTGGAAGAAGAATTGTCTTGG + Intergenic
982693500 4:158573553-158573575 CATTGGAAGAAGAGTTGTCTTGG - Intronic
982941281 4:161560108-161560130 CAATGGAAGAAGAATTGTCTTGG - Intronic
983114832 4:163801674-163801696 CTTAGGAAGAGGAATTGACTGGG - Intronic
983390900 4:167128590-167128612 CTGAAGAAGAAGAATTGTCTTGG + Intronic
983519771 4:168695973-168695995 CACTGGAAGAAGAATTACCTGGG + Intronic
983556909 4:169067453-169067475 CATTGGAAGAAGAATCGTCTTGG - Intergenic
983561504 4:169106373-169106395 CACTGAAGGAAGAATTGTCTTGG - Intronic
983564990 4:169141046-169141068 CATTGGAAGAAGAATTGTCCTGG - Intronic
983722846 4:170878834-170878856 CATTGGAAGAATAATTATCTTGG - Intergenic
983743517 4:171165481-171165503 CACTGGAAGAAGAATTGTCTTGG - Intergenic
983833283 4:172358579-172358601 CACTGGAAGAAAAATTGTCTTGG - Intronic
983849982 4:172568968-172568990 CACTGGAAGAAGAATTCTCTTGG - Intronic
983867811 4:172789473-172789495 CATTGGAAGAAGAATTATATTGG - Intronic
984723063 4:182994531-182994553 CGTTGGAAGAAGAATTGTCTTGG - Intergenic
984747520 4:183236982-183237004 CATTTAAAGAAGAATTGTCTTGG + Intronic
984812719 4:183808828-183808850 CATAGGAAGAAGAATTGTCTTGG + Intergenic
985089682 4:186350473-186350495 CATTGGAAGAAGAATTGTCTTGG - Intergenic
985306221 4:188543552-188543574 CATTGGAAGAAGAATTGTCTTGG + Intergenic
985432759 4:189897242-189897264 CACTGGAAGAAGAATTGTCTTGG + Intergenic
985473875 5:66407-66429 CATTGGAAGAAGAATTGTCTTGG - Intergenic
985749564 5:1666563-1666585 CACTGGAAGGAGAATTGTCTTGG + Intergenic
985925871 5:3018077-3018099 CATTGGAAGAACAATTGTTTTGG - Intergenic
986022415 5:3816967-3816989 CACTGGAAAGAGGATTGTCTTGG + Intergenic
986024195 5:3834910-3834932 CATTGGAAGAAGAATTGTCTTGG - Intergenic
986217989 5:5738838-5738860 TATTGGAAGAAGAATTGAAAGGG - Intergenic
986725184 5:10590667-10590689 CAATGGAAGAAGAATTGTCTTGG - Intronic
986910437 5:12549115-12549137 CATTTGAAAAAGAATTGTCTTGG - Intergenic
987254293 5:16133737-16133759 CAATGGAAGAAGAATTGTCTTGG + Intronic
987341742 5:16945561-16945583 CAATGGAAGAAAAATTGTCTTGG - Intergenic
987785296 5:22491546-22491568 CACTGGAAGAAGAATTGACTTGG + Intronic
987950101 5:24663553-24663575 CATTGACATAAGAATAGTCTTGG - Intergenic
988570406 5:32359367-32359389 CATTGAAAGAAGAATTGTGTTGG - Intronic
988830601 5:34983352-34983374 CAATGGAAGGAGAATTGTCTTGG - Intergenic
988901215 5:35734388-35734410 CAAGGGAAGAATAATTCTCTTGG + Intronic
988942902 5:36163915-36163937 CAGTGGAAGAGGAATTTCCTGGG + Intronic
989009539 5:36854822-36854844 CATTAGAAAAAGAATTGTCTCGG + Intergenic
989020822 5:37005132-37005154 CAGTGGAAGAAGAATTGTCTTGG - Intronic
989033170 5:37140914-37140936 CATTGGAAGAAGAATTGTCTTGG - Intronic
989142606 5:38216779-38216801 CATTGGAAGAAGAATTGTCTTGG + Intergenic
989216132 5:38906802-38906824 CTTTGAAAGAAGAACTGTTTTGG - Intronic
989644968 5:43621317-43621339 CACTGGAACAAGAATTGTCTTGG - Intronic
989718450 5:44493892-44493914 CACTGGAAGAATAATCGTCTTGG + Intergenic
990012445 5:51016121-51016143 CAGTGGAAGAAGAATTGTCTTGG - Intergenic
990051803 5:51511418-51511440 CAGTGGTAGAAGAATTGTCTTGG - Intergenic
990321568 5:54634586-54634608 CATTGGGAGAAGAATTGTCCTGG - Intergenic
990372574 5:55135822-55135844 CATTGGAAGAAGGATTGTTTTGG - Intronic
990841907 5:60091070-60091092 AATTGGAAGAACACTGGTCTGGG + Intronic
990992682 5:61701038-61701060 CATTGGAAGAAGAATTCTCTTGG - Intronic
991139129 5:63218653-63218675 GACTGAAAGGAGAATTGTCTAGG - Intergenic
991186240 5:63811781-63811803 CACTGGAAGGAGAATTGTCTTGG - Intergenic
991406688 5:66306690-66306712 CATTGGAAGAAGAATAGTCTTGG + Intergenic
991412827 5:66361910-66361932 CATTGGAAGAAGAATTATCTTGG - Intergenic
991431003 5:66546377-66546399 CACTGGAAGAAGAATTGTCTTGG + Intergenic
991457135 5:66816283-66816305 CATCGGAAGAAGAATTGTCTTGG - Intronic
991484610 5:67121611-67121633 CACTGGGAGAAGAACTGTCTCGG + Intronic
991634488 5:68690543-68690565 CATTGAGAGAAGAATTGTCTTGG + Intergenic
991655436 5:68899409-68899431 CATAGGAAGCAGATTTGGCTCGG + Intergenic
992015072 5:72567221-72567243 CATTGGAACAAGAATCTTATAGG - Intergenic
992029262 5:72704964-72704986 CATTGGAAGAAGAATTGTCTTGG - Intergenic
992194971 5:74330172-74330194 CACTGGAAGAACAATTGTCTTGG - Intergenic
992226672 5:74625522-74625544 CATTAGAAGAAGAATTGTCTTGG + Intergenic
992569299 5:78038388-78038410 CATTGGAAGAAGAATTGTCTTGG + Intronic
992725967 5:79607693-79607715 CACTGGAAGAAGAATTGTCTTGG - Intergenic
992835698 5:80639217-80639239 CATTGGAAGAAGAATTGTCTTGG + Intronic
992916708 5:81462102-81462124 CACTGGAAGAAGAACTGTCTTGG + Intronic
993064650 5:83082786-83082808 CACTGGAGGAAGAATTGTCTTGG - Intronic
993110036 5:83645535-83645557 CATTGGAAGAAGAACTGTCTTGG - Intronic
993490826 5:88545784-88545806 TATTGTAGGAAGAATTGTTTTGG + Intergenic
993499708 5:88651547-88651569 CATTGGAAGAATAATCGTCTCGG + Intergenic
993816682 5:92557079-92557101 CATTGGAAGAAGAATTGTCTTGG + Intergenic
993996673 5:94731256-94731278 CAATGGAAGAAGAATTGTCTTGG - Intronic
993996733 5:94732385-94732407 CACTGGAAGAAAAATTGTCTTGG - Intronic
994111160 5:96006300-96006322 CAATGGAAGAAGAATTGTCTTGG + Intergenic
994281668 5:97911253-97911275 CATTGGAAGAAGAATTGTCTTGG + Intergenic
994475573 5:100264366-100264388 CATTGAAAGAATAATTGTCTTGG - Intergenic
994540004 5:101082618-101082640 CAATGGAAGGAGAAGTGCCTGGG + Intergenic
994666861 5:102715822-102715844 CGTTAGAAGAAGAATTATCTTGG - Intergenic
994684255 5:102929930-102929952 CATTGGAAGAAGAATTGTCTTGG - Intronic
994761341 5:103858108-103858130 CATTGGAAGAAGAATTGTCTTGG - Intergenic
995142708 5:108750437-108750459 CTTTGGAAGCATAATTCTCTTGG - Intronic
995227648 5:109720615-109720637 CATTGGAAGAAAAATTGTCTTGG + Intronic
995751575 5:115458022-115458044 CATGGGAAGAAGGATTGTGCTGG + Intergenic
996028815 5:118682538-118682560 CATTGACAGAAGAAATGTTTAGG - Intergenic
996357419 5:122612223-122612245 CACTGGAAGAAGAATTGTCTTGG + Intergenic
996377252 5:122824301-122824323 CAATGGAAGAAGAATTGTCTTGG - Intronic
996536494 5:124583295-124583317 CATTTGGAGAATCATTGTCTTGG - Intergenic
996650208 5:125866628-125866650 CATTGGAAGAAGAATTGTCTTGG - Intergenic
996833382 5:127764672-127764694 TAGAAGAAGAAGAATTGTCTTGG + Intergenic
996898105 5:128510191-128510213 CACTGGAAGAAGAATTGTCTTGG + Intronic
996925043 5:128814962-128814984 CATTACAAGAAGCATTGCCTGGG + Intronic
997214361 5:132098018-132098040 CAATGGAAGAAGAATTGTCTTGG + Intergenic
997215244 5:132104479-132104501 CTTTGGAAGAAGAATTGTCTTGG + Intergenic
997606878 5:135181475-135181497 CATTGGAAGAAGAATTGTCTTGG - Intronic
998003805 5:138644138-138644160 CATTGGAAGAAGAACTGTGTTGG - Intronic
998101414 5:139438425-139438447 CATTGGAAGAAGAATTGTCTTGG - Intronic
998866105 5:146504718-146504740 CATTGGAAGGAGAATTGTCTTGG + Intronic
998916269 5:147014999-147015021 CCTTGGAACAAGAAGTGTTTGGG - Intronic
998931837 5:147189788-147189810 CAGAAAAAGAAGAATTGTCTTGG + Intergenic
999053757 5:148551683-148551705 CATTGGAAGAAGAATTGTCGTGG + Intronic
999077778 5:148813257-148813279 CACTGGAAGGAGGATTGTCTTGG - Intergenic
999077784 5:148813284-148813306 TATTGGAAGAAGAATTGTCTTGG - Intergenic
999595956 5:153204888-153204910 CATCGAAAGAAGAATTGTCTTGG + Intergenic
999635378 5:153616410-153616432 CTTTGGAAGAAGAATTGTCTTGG + Intronic
999771836 5:154781811-154781833 CAATGGAAGAATTAATGTCTTGG - Intronic
999789591 5:154926715-154926737 CACTGGAAGCAGAATTGTCTTGG + Intronic
1000027849 5:157375695-157375717 TACTGGAAGAAAAATTGTCGTGG - Intronic
1000212969 5:159126055-159126077 CATTGGAAGACAAAGTGTCTTGG + Intergenic
1000217303 5:159173300-159173322 CATTGGAAGAAGAATTGTCTTGG - Intronic
1000219235 5:159196299-159196321 CATTAGGAAAATAATTGTCTTGG - Intronic
1000344179 5:160300594-160300616 CACTGGAAGAAGAATTGCCTTGG - Intronic
1000351435 5:160355858-160355880 CATTGGAAGAAGAATTGTCTTGG - Intronic
1000378172 5:160603494-160603516 CAATGGAAGAAGAATTGTATTGG - Intronic
1000436401 5:161216101-161216123 CATGGTAAGAAGAACAGTCTGGG + Intergenic
1000569330 5:162892572-162892594 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1000652349 5:163832693-163832715 CACTGTAAGAAGAATTGTCCTGG - Intergenic
1000740629 5:164965415-164965437 CAGTGGAAGAAGAATTGTCTTGG + Intergenic
1001464667 5:171952925-171952947 CATTGGAAGAAGAATTGTCTTGG - Intronic
1002006281 5:176237761-176237783 CCCAGGAAGAAGAATTGTGTTGG - Intergenic
1002155291 5:177273247-177273269 CACTGGAAGAAGAATTGTCTTGG + Intronic
1002220094 5:177672876-177672898 CCCAGGAAGAAGAATTGTGTTGG + Intergenic
1002768018 6:259764-259786 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1002820615 6:721097-721119 CACTGGAAGAAGGATTGTCTTGG - Intergenic
1003105850 6:3215208-3215230 TATTGGAAGAAGAGTTGTCTTGG - Intergenic
1003329095 6:5114674-5114696 CACTAGAAGAAGAATTGTCTTGG + Intronic
1003666465 6:8116147-8116169 CACTGGAAGAAGGATTGTCCTGG + Intergenic
1003900628 6:10651948-10651970 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1004236004 6:13874926-13874948 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1004375053 6:15083795-15083817 TACTGGAAGAAGAATTGTCTTGG + Intergenic
1004379935 6:15123983-15124005 CATTGGAAGAATAATTATCTTGG + Intergenic
1004490003 6:16105558-16105580 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1004609170 6:17222724-17222746 TGTTGGAAGAAGAATTGTCTTGG + Intergenic
1004922592 6:20390536-20390558 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1004982274 6:21038735-21038757 CACTGGAAGAAGAATTGTCTTGG - Intronic
1005116209 6:22340398-22340420 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1005123087 6:22412826-22412848 CATCGGAAGAAGAATTGTCTTGG - Intergenic
1005416848 6:25608932-25608954 CAGTGGAAGAAGAATTGTCTTGG + Intronic
1005427105 6:25714253-25714275 CATTTGAATAAGCATTTTCTGGG + Intergenic
1005649139 6:27870470-27870492 CGTTGGAAGAAGAATTGTCTTGG - Intergenic
1005718989 6:28582311-28582333 TATTGGAAGAATAATTGTCTTGG - Intronic
1006288981 6:33119773-33119795 GGTTGAAAGAAGAATTGTGTAGG + Intergenic
1006319044 6:33308791-33308813 CACTGGGAGAAGAATTGTCTTGG - Intronic
1006711750 6:36079435-36079457 CATTGGAAGAAGAAATGTCCTGG + Intronic
1006740550 6:36305246-36305268 CACTGGAAGAAGAATTGTCTTGG - Intronic
1007479300 6:42139753-42139775 CATTGGAAGAAGAATTGTCTTGG - Intronic
1008089760 6:47282028-47282050 CACTGGAAGAAGAATCGTCTTGG + Intronic
1008182345 6:48347032-48347054 CAATGGAAGAAGAATTGTCTTGG + Intergenic
1008394421 6:50990461-50990483 CATTGGAAGAAGAATTATCTTGG - Intergenic
1008667343 6:53729126-53729148 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1008827547 6:55715807-55715829 CACGGGAAGAAGAATTGTCATGG - Intergenic
1009426858 6:63523784-63523806 CACTGAAAGAAGAATTGTCTGGG - Intronic
1009566288 6:65314955-65314977 CATTGGAATGAGAAGTGTTTTGG - Intronic
1009646881 6:66415503-66415525 CATTGGAAGAAGTATTGTCTCGG - Intergenic
1009915452 6:69989612-69989634 CATTGGAAGAAGAATTATCTTGG - Intronic
1010056213 6:71568435-71568457 CACTGGAAGGAGAATTGTCTTGG - Intergenic
1010455109 6:76045202-76045224 CATTTGTAGAACATTTGTCTTGG - Intronic
1010462232 6:76126530-76126552 CATTAGAAGAGGAATGTTCTTGG + Intergenic
1010583339 6:77626829-77626851 CATTGGAAGAAGAATTGTTTTGG - Intergenic
1010746010 6:79562732-79562754 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1010748016 6:79586304-79586326 TATTGGAAGAAGAATTGTCTTGG - Intergenic
1010826438 6:80482508-80482530 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1010903302 6:81454400-81454422 CATTGGAAGAACAATTGTCTTGG - Intergenic
1011097741 6:83684889-83684911 CATTTTAAGAATAATTGTCATGG - Intronic
1011134927 6:84089881-84089903 CACTGGAAGAAGAGTTGTCTTGG - Exonic
1011349753 6:86409303-86409325 CATTGGCAGAAGAATTATAGAGG + Intergenic
1011428760 6:87261135-87261157 CATTTGAAGAAGTATTAGCTTGG - Exonic
1011501497 6:87995481-87995503 CTGTGGAATAAGAAATGTCTGGG + Intergenic
1011646930 6:89468533-89468555 CATGGGAAGAAGAATTGTCTTGG + Intronic
1012702419 6:102477276-102477298 CATTGGAAGAAGAACTGTCTTGG - Intergenic
1013128250 6:107206608-107206630 CACTGGAAGAAGAATTGTCTTGG + Intronic
1013136029 6:107283423-107283445 AAATAGGAGAAGAATTGTCTGGG + Intronic
1013789602 6:113822032-113822054 CACTGGAATAAGAATTGTCTTGG + Intergenic
1013916329 6:115341948-115341970 ATTTGGAAGAAGAATTCTCTTGG - Intergenic
1013949334 6:115760619-115760641 AAAAGGAAGAAGAATTGGCTGGG - Intergenic
1014101883 6:117520162-117520184 CATTAGAAGAAGAATTGTCTTGG + Intronic
1014402311 6:121005953-121005975 CATAGGAAGGTGAATTGTGTGGG + Intergenic
1014517957 6:122402102-122402124 CACTGGAAGAAGAATTGTCTTGG - Intronic
1014711995 6:124817298-124817320 TAGAAGAAGAAGAATTGTCTTGG - Intronic
1014734380 6:125075206-125075228 TAGAAGAAGAAGAATTGTCTTGG - Intronic
1014739946 6:125137491-125137513 CATCGGAAGACAAATTGTCTTGG + Intronic
1014749128 6:125235344-125235366 CACTGGAAGGAGAATTGTCTTGG + Intronic
1014822228 6:126003327-126003349 CATTCGAAGAAGAATTGTCTTGG - Intronic
1015145980 6:129987539-129987561 TACTGGAAGAAGAATTGTCTTGG + Intergenic
1015646073 6:135390078-135390100 CATTGGAAGAAGACTTGTCTTGG - Intronic
1015991978 6:138954436-138954458 CACTGGAAGAAGAACTGTTTTGG + Intronic
1016054091 6:139560545-139560567 CAATGGAAGAAGAATTGTCTTGG - Intergenic
1016133880 6:140513434-140513456 TATTGGATGAAGAATTGTCTTGG - Intergenic
1016208197 6:141496297-141496319 CAATGGAAGAATAATTGTCTTGG - Intergenic
1016358739 6:143245947-143245969 CATTGGAAGAAGAATTGTCTTGG + Intronic
1016398839 6:143656362-143656384 CATTGGAAGTAGAATTGTCTTGG + Intronic
1016872044 6:148827319-148827341 CATTGAAAAAAGAAGAGTCTGGG + Intronic
1017109076 6:150915319-150915341 CACTGGAAGAAGAATTGTCTTGG - Intronic
1017532329 6:155307737-155307759 CACTGGAAGAAGAACTGTCCTGG + Intronic
1017714335 6:157197740-157197762 GATTAGAAGAACAATTATCTGGG + Intronic
1017861045 6:158397613-158397635 CACTGGAAGAAGAATTGTCTTGG - Intronic
1017961649 6:159227750-159227772 CATTGGAAGAAGAATTGTCTTGG + Intronic
1018371663 6:163174160-163174182 CATTAGAAGAAGAATTGTCTTGG + Intronic
1018713079 6:166511248-166511270 CATTGGATGAAGGATTGTTAGGG - Intronic
1018815411 6:167326789-167326811 CATTGGAAGAAGAATTGTCTTGG - Intronic
1019009450 6:168831315-168831337 CACTGGAAAAAGAATTGTCTTGG - Intergenic
1019508605 7:1405808-1405830 CAATGGAAGAATAAATGTGTCGG - Intergenic
1019825144 7:3278438-3278460 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1019873420 7:3788600-3788622 CGTTGGAAAAAGAATTGTCTTGG + Intronic
1020205581 7:6112792-6112814 CACTGGAAGACAAATTGTCTTGG - Intronic
1020354640 7:7263335-7263357 CACTGGAAGAAGAACTGTCTTGG - Intergenic
1020613948 7:10435295-10435317 TATTGGAAGAAGAATTGTCTTGG + Intergenic
1020832872 7:13113146-13113168 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1020966447 7:14875884-14875906 CATTGGAAGAAGAATTGTCTTGG - Intronic
1020975536 7:15001560-15001582 CACTGGAGGAAGAATTGTCTTGG + Intergenic
1021144733 7:17071023-17071045 CATCAGAAAAAGAATTTTCTGGG + Intergenic
1021438641 7:20651896-20651918 CATTGAAAGAAGAATTGTCTTGG - Intronic
1021696982 7:23285465-23285487 CATTCGAAAAAGAATTGTCTTGG - Intergenic
1021697870 7:23291546-23291568 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1021929166 7:25562396-25562418 CTTTGGAATAAGAGTTGTGTGGG + Intergenic
1022053460 7:26703169-26703191 CAGAAGAAGAAGAATTGTCTTGG + Intronic
1022118762 7:27286539-27286561 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1023040917 7:36172684-36172706 CAATGGAAGAAGAATTGTCTTGG - Intronic
1023184188 7:37516093-37516115 TAATGGAAGGAGAATTGTCATGG + Intergenic
1023311947 7:38896599-38896621 CATTGGAAGAAGAATTGTCTTGG - Intronic
1023388522 7:39684653-39684675 CATTGGAAGAAGAATTGTCTTGG + Intronic
1023427452 7:40053387-40053409 CATTGTAAATAGAATTGTATTGG + Intronic
1023566618 7:41529637-41529659 TATTGGAAGCAGAAGTGTGTTGG - Intergenic
1024395009 7:48856152-48856174 TATAAGAAGAAGAATTGTCTTGG - Intergenic
1024400260 7:48916524-48916546 TATAAGAAGAAGAATTGTCTTGG + Intergenic
1024682626 7:51708854-51708876 CCTTGGAAGAAGAATTGTCTTGG - Intergenic
1024727911 7:52220481-52220503 CATTAGAAGAAGAATTGTTTTGG + Intergenic
1025320624 7:58089525-58089547 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1025482149 7:60994160-60994182 CATTAGAAGAAGAATGCTCCTGG + Intergenic
1025553124 7:62274187-62274209 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1025562270 7:62382251-62382273 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1025878055 7:65507506-65507528 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1025882392 7:65553301-65553323 CATTGGAAGAAGAATGCTCCTGG - Intergenic
1025891050 7:65649302-65649324 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1026060934 7:67025307-67025329 CATTGGTAGAAAAAATGTCTTGG + Intronic
1026115780 7:67494620-67494642 CACTGGAAGAAGGATTGTCTTGG - Intergenic
1026238939 7:68554992-68555014 CATAGGAAAAAGAATTTCCTGGG - Intergenic
1026513069 7:71043622-71043644 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1026717433 7:72802093-72802115 CATTGGTAGAAAAAATGTCTTGG - Intronic
1026815991 7:73512357-73512379 TATTGGAAGAAGAATTGTCTCGG - Intronic
1027289722 7:76692839-76692861 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1027409864 7:77905052-77905074 CACTGCAAGAAGAAATGTCTGGG - Intronic
1027529346 7:79311275-79311297 CCTTGGAAGAAGAATTGTCTTGG + Intronic
1027647273 7:80818581-80818603 CACTGGAAGAAGAATTGTCTTGG + Intronic
1027748846 7:82115163-82115185 AATTGGAAGAAAAACTGGCTGGG - Intronic
1027916443 7:84329459-84329481 CATTGGGAGAAGTATTGTCTTGG - Intronic
1028254586 7:88578222-88578244 CATTGGAAGAAGAATTGTCCTGG + Intergenic
1028357617 7:89928263-89928285 CACTGAAACAAGAATTGTCTTGG + Intergenic
1028361964 7:89978911-89978933 CATTCCAATAAGAATTGTCTGGG + Intergenic
1028509475 7:91607971-91607993 CATTGGAATAAGTTTTATCTAGG - Intergenic
1028575653 7:92347360-92347382 CACTGGAAGAAGAACTGTCTTGG - Intronic
1028802290 7:94980123-94980145 CACTGGAAGAAGAATCGCCTTGG + Intronic
1029287246 7:99474200-99474222 CATTGGAAGAAGAATTGTCTTGG + Intronic
1029311514 7:99671179-99671201 CAGTGGAAGAAGAAGTGTCGTGG - Intronic
1029332783 7:99873465-99873487 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1029614714 7:101649136-101649158 CATCGGAAGAAGAACTGTCTTGG - Intergenic
1029615140 7:101651555-101651577 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1030661536 7:112224229-112224251 CATTGGAAGAAGAATTGTCTTGG + Intronic
1030756036 7:113289090-113289112 CATTGGAAGAAGAACTGTTTTGG + Intergenic
1031477164 7:122237197-122237219 TAGAAGAAGAAGAATTGTCTTGG + Intergenic
1031603085 7:123737085-123737107 CATTCAAAGAAGAATTGTTTTGG + Intronic
1031686769 7:124739861-124739883 CATTGGATGAAGAATTGTCTTGG + Intergenic
1031758133 7:125673491-125673513 CATTGGAAGAGGAATTGTCCTGG - Intergenic
1032182625 7:129693600-129693622 CATTAGAGGAAGAATTATCTTGG - Intronic
1032341237 7:131075232-131075254 TACTGGAAGAAAAATTGTCTTGG + Intergenic
1032376009 7:131418438-131418460 CATTGGAAGAAGAATTGTCTTGG + Intronic
1032761740 7:134949842-134949864 CATTGGAAGAAGAATTGCCTTGG + Intronic
1033094007 7:138413853-138413875 CTTTGAAAGAAGAATTGTCTTGG + Intergenic
1033330242 7:140411475-140411497 TGTTGGAAGAAGAATTGTCTTGG + Intronic
1033713689 7:143977085-143977107 CAAAGGAAGAAGAATTGTCTTGG - Intergenic
1033969427 7:147021254-147021276 CATTGAAAGAAGAATTGTCTTGG - Intronic
1034089293 7:148349317-148349339 CATTGGAAGAAGAATTGTTTTGG + Intronic
1034597375 7:152210595-152210617 CAATGGAAGAAGCATTGTCTTGG - Intronic
1034745191 7:153517919-153517941 CACTGAAAGAAGAATTGTCTTGG - Intergenic
1035061766 7:156074740-156074762 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1035397482 7:158544722-158544744 CACTGGAATAAGAATTATCTTGG - Intronic
1035433053 7:158836835-158836857 GATTAGAAGAAGAATGGTCCAGG - Intergenic
1035477998 7:159157286-159157308 CAGTGGAAGAAGAAATGTCGTGG + Intergenic
1035667685 8:1391118-1391140 CTTTGGAGGCAGAAATGTCTGGG + Intergenic
1035865043 8:3072965-3072987 CATTAGGAGAAGAGTTGACTGGG - Intronic
1035866408 8:3087579-3087601 CACTGGAAGAAGAATTGTCTTGG + Intronic
1035965028 8:4181431-4181453 CATTGGAAAAAGAACTGTCTTGG + Intronic
1036585084 8:10116309-10116331 TATTGGAAGAAGAACTGCCTTGG - Intronic
1037060126 8:14497650-14497672 CATTGGAAGAAGAGTCATCTTGG - Intronic
1037065888 8:14576745-14576767 CAGTGGAAGAAGCATTGTGTTGG + Intronic
1037243933 8:16809111-16809133 CATTGAAAGAAGAATTGTCTTGG - Intergenic
1037256601 8:16962328-16962350 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1037280865 8:17240410-17240432 CACTAGAGGAAGAATTGTCTTGG - Intronic
1037899894 8:22681834-22681856 CATCTGAGGAAGAACTGTCTGGG - Intergenic
1038249293 8:25888045-25888067 CATTGGAAGAAGAATTGTCTTGG + Intronic
1038285459 8:26202746-26202768 CATTCAAAGAAGAAATGTCTTGG - Intergenic
1038420644 8:27432044-27432066 CATTGGAAGAAGAATTGTCTTGG - Intronic
1038557480 8:28535151-28535173 AATTTGAAGAAAAATTGGCTGGG + Intronic
1038661508 8:29501495-29501517 CAGTGGAGGAAGAATGATCTTGG - Intergenic
1038681955 8:29676857-29676879 TATTAGAAGAAGAATTGTTTTGG + Intergenic
1038965120 8:32563183-32563205 CATTGGAAGAAGAATTATCTTGG - Intronic
1039052114 8:33504594-33504616 CAGTGGAAGAAGAATTGTCTTGG + Intronic
1039070936 8:33648734-33648756 GATTGGAATAAGCATTTTCTGGG + Intergenic
1039151809 8:34514945-34514967 ACTTGTAAGAAGAATTGGCTTGG + Intergenic
1039218960 8:35307049-35307071 CATTAGAAGAAGAATTGTCTTGG + Intronic
1039504090 8:38039217-38039239 CACTGGAAGAAGAATTGTCTTGG - Intronic
1039749834 8:40467719-40467741 CACTGGAAAAAGAATTGTCTTGG - Intergenic
1039809368 8:41032398-41032420 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1040030900 8:42822785-42822807 CATTGGAAGAAGAATTGTATTGG + Intergenic
1040472740 8:47749116-47749138 CATTTAAAGAAAAATTGGCTGGG + Intergenic
1040622554 8:49106139-49106161 CATTGGAAGAAGAATTGTCATGG - Intergenic
1040698656 8:50034652-50034674 CACTGGAGAAAGAATTGTCTTGG + Intronic
1040722858 8:50347594-50347616 CATTGGAGGAATCATTATCTTGG - Intronic
1040842791 8:51802530-51802552 CACTGGAAGAAGAATTGTCTTGG - Intronic
1041023641 8:53661752-53661774 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1041064133 8:54064774-54064796 CATTGGAAGAAGAATTGTCTTGG + Intronic
1041184831 8:55288102-55288124 CATTGGAAGAAGAATTGTCTTGG - Intronic
1041476178 8:58268984-58269006 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1041531642 8:58874836-58874858 CATTTGGAGAAGAACTGTCTTGG + Intronic
1041678390 8:60560801-60560823 CACTGGAAGAATAACTGTCTTGG - Intronic
1041756129 8:61315076-61315098 CCTTGGAAGAAAAACTGCCTAGG - Intronic
1041855870 8:62454237-62454259 CATTGGGAGAAGAATTGTCTTGG + Intronic
1042294578 8:67205372-67205394 CATTGGAAGAAGAATTGTCTTGG - Intronic
1042451317 8:68950134-68950156 TGTTGGAAGAAGAATTGTCTTGG + Intergenic
1042587312 8:70355634-70355656 CATTGAAAGAAGAATTGTCTTGG - Intronic
1042648074 8:71009390-71009412 CACTGGAAGAAGAATTCTCTTGG - Intergenic
1042828401 8:73001182-73001204 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1042945700 8:74152601-74152623 CATTGCAAGAAGAATTGTCTTGG + Intergenic
1042951927 8:74209404-74209426 CGGAAGAAGAAGAATTGTCTTGG - Intergenic
1042955933 8:74250674-74250696 AAGAAGAAGAAGAATTGTCTTGG - Intronic
1043299559 8:78709654-78709676 CACTGAAAGAAGAATTGTCTTGG + Intronic
1043392654 8:79806807-79806829 CATTGGCAGATGAATTTGCTGGG - Intergenic
1043499686 8:80840387-80840409 CATTGGAAAAAGAATTGTCTTGG - Intronic
1043566529 8:81554738-81554760 CATTGAAAGAAGAATTGTCTCGG + Intergenic
1043575268 8:81649432-81649454 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1044208914 8:89526338-89526360 AATTGGAAGAAGAATTGTCTTGG - Intergenic
1044346337 8:91108792-91108814 CATTGGAAGAAGAATTATCTTGG - Intronic
1044367404 8:91365247-91365269 CACTGGAAGAAGAATTGTCTTGG + Intronic
1044879380 8:96707523-96707545 CACTGGAAGAAGAATTGTCTTGG - Intronic
1045247173 8:100453198-100453220 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1045256881 8:100532625-100532647 CAATGGAAGAAGAATTGTCTTGG + Intronic
1045259631 8:100560762-100560784 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1045367038 8:101485856-101485878 AATTAGAAGAAAAATTGTCTTGG - Intergenic
1045384745 8:101661195-101661217 CATTGAAAGAAGAATTGTCTTGG - Intronic
1046009161 8:108525377-108525399 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1046039528 8:108885425-108885447 AATTGGAAGACAGATTGTCTGGG + Intergenic
1046094964 8:109546687-109546709 CACTGGAAAAAGAATTATCTTGG - Intronic
1046200602 8:110922861-110922883 TTTTGGAAGATGAATTGTCCTGG + Intergenic
1046726831 8:117684796-117684818 CACTGGAAGAAGAATTGTTTTGG + Intergenic
1046744701 8:117864387-117864409 GGATGGAAGAAGAATTGTCTTGG + Intronic
1046764579 8:118056007-118056029 CACTGGAAGAAGAACTGTCTTGG + Intronic
1046903075 8:119543561-119543583 CATTGGAAGAAGAATTACCTTGG - Intergenic
1047005631 8:120617158-120617180 CATTAGAAGAAGAATTGTCTTGG - Intronic
1047279634 8:123433983-123434005 CACTGGAAGAAGAATTGTCTTGG - Intronic
1047305590 8:123650243-123650265 CATTGGAAGGAGAGTTGTCTTGG + Intronic
1047408112 8:124602091-124602113 CAGTGGAAGAGGAATTGTCTTGG + Intronic
1047486068 8:125331853-125331875 CAGTGGAAGAAGTCTGGTCTGGG + Intronic
1048038470 8:130700935-130700957 CTTTGGAAGAAGAATTGTCTTGG + Intergenic
1048048739 8:130797291-130797313 CAATGAAAGAAGAATTGTCTTGG - Intronic
1048373289 8:133799229-133799251 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1048689066 8:136938199-136938221 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1048698572 8:137057384-137057406 CATGTGAAGAAGAATTCTCTTGG + Intergenic
1049174967 8:141186584-141186606 CAGTGGAAGAAGAATTGTCTTGG - Intronic
1050044053 9:1525207-1525229 CATCGGAAGAAGAATTGTCTTGG + Intergenic
1050455113 9:5827291-5827313 CATTAAGAGAAGAACTGTCTTGG + Intronic
1050591512 9:7164965-7164987 TATTTGAAAAAGAATTGTTTAGG - Intergenic
1050713786 9:8496893-8496915 CATTGGAAGAAGAATGGTCTTGG - Intronic
1050749483 9:8920519-8920541 CACTGGAAGAAGAATTGTCTTGG + Intronic
1050780477 9:9327839-9327861 CGTTGGAAGAAGAATTGTTTTGG + Intronic
1050974614 9:11921493-11921515 CACTGGAAGAAGAATTGTCTAGG - Intergenic
1051389618 9:16550311-16550333 CATTGGAAGAAGAATTGTTTTGG - Intronic
1051390617 9:16559334-16559356 CAATGGAAGAAGAATTGGCTTGG - Intronic
1051763689 9:20498690-20498712 CATTGGAAGAAGAATTGTCTTGG - Intronic
1052212553 9:25923485-25923507 AATTGGAAGAAGAATTTTCTTGG - Intergenic
1052535765 9:29744996-29745018 CTTTGGAATAAGATTTGTATTGG - Intergenic
1052823079 9:33154888-33154910 CACTGGAAGAAGAATTGTCTTGG - Intronic
1052916018 9:33924954-33924976 CATTGAAAGAATAATTGTCTTGG - Intronic
1053079958 9:35167392-35167414 CAGTGGAAGAAGAATTATCTCGG - Intronic
1053445210 9:38147285-38147307 CACTGGAAGAATAATTGTCTGGG - Intergenic
1054861375 9:69957265-69957287 AACTGGAAGAAAAATTGTCTTGG - Intergenic
1054883597 9:70171767-70171789 CATTGGAAGAAGAATTGTCTTGG + Intronic
1054989825 9:71311728-71311750 CATTCAAAGAAGAATTGTCTTGG + Intronic
1055027703 9:71739820-71739842 CATTGGAAGAAGAATTGTCTTGG - Intronic
1055144988 9:72922540-72922562 CATGGGAAGAAGAATTGTCTTGG + Intronic
1055212786 9:73817506-73817528 AAATGGAAGATGAACTGTCTAGG - Intergenic
1055451922 9:76438736-76438758 CATTGGAAGAAGAATTGTCTTGG + Intronic
1055830672 9:80374922-80374944 CACTATAAGAAGAATTGTCTTGG - Intergenic
1056136321 9:83632493-83632515 CACTGGAAGAAGAATTGTCTTGG + Intronic
1056154707 9:83822688-83822710 CACTGGAAGAAGAATTGTCTTGG + Intronic
1056355507 9:85797660-85797682 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1056368120 9:85926493-85926515 CATAGGCAGAGAAATTGTCTAGG - Intergenic
1056480004 9:86992847-86992869 TACTGGAAGAAGAATTGTCTTGG - Intergenic
1056784131 9:89576614-89576636 CATTGGTAGAAGAATTGCCTTGG + Intergenic
1056871024 9:90278857-90278879 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1056889197 9:90474068-90474090 AAGAAGAAGAAGAATTGTCTTGG + Intergenic
1057036005 9:91811985-91812007 CACTGGAAGAAGAATTGTCTTGG + Intronic
1057120244 9:92565229-92565251 CATTGGAAGAAGAACTGTCTTGG + Intronic
1057563590 9:96148316-96148338 CATTGGAAGGAGAATTGTCTTGG - Intergenic
1057947312 9:99340818-99340840 CAATGGATGAGGAATTGTCTTGG + Intergenic
1058023200 9:100112600-100112622 TATTGGAAGAAGAATTGTCTTGG + Intronic
1058072456 9:100615361-100615383 TGGAGGAAGAAGAATTGTCTTGG + Intergenic
1058200925 9:102039407-102039429 TGGAGGAAGAAGAATTGTCTTGG + Intergenic
1058480310 9:105386630-105386652 TCCTGGAAGAAGAATTGTCTTGG - Intronic
1058524560 9:105844022-105844044 CATTGGAAGAAAAGTTGTCTTGG + Intergenic
1058586660 9:106514324-106514346 CGTTGGGGGAAGAATTGTCTTGG + Intergenic
1058731036 9:107850138-107850160 CATTGGAATAAGAGTTGTCTTGG + Intergenic
1058744899 9:107980974-107980996 CATTGAAAGAAACATTGGCTTGG + Intergenic
1059308113 9:113370353-113370375 CATTTGAAGAAGAATTTTCTTGG + Exonic
1059391166 9:114000535-114000557 CACTGGAAGAAGAATTGTCTTGG - Intronic
1059478798 9:114571726-114571748 CGGAAGAAGAAGAATTGTCTTGG + Intergenic
1059521379 9:114945441-114945463 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1060005267 9:119994019-119994041 CAATAGAAAAAGAATGGTCTAGG - Intergenic
1060118021 9:120960723-120960745 CATTGGAAGAAGAATTGTCTTGG - Intronic
1061140284 9:128762169-128762191 CACTGGAAAAGGAACTGTCTTGG - Intronic
1061197199 9:129112991-129113013 CATTGGAAGCAGAATTGTCTTGG + Intronic
1061472826 9:130841058-130841080 CATTGGGAGAAAAATTGTCTTGG + Intronic
1061525903 9:131162062-131162084 CACTGGAGGAAGAATTGTCTTGG - Intronic
1062026596 9:134343496-134343518 CATGGGAAGAAGCATTTTTTTGG + Intronic
1203571207 Un_KI270744v1:133303-133325 CATTGGAAGAAGATTTGTCTTGG - Intergenic
1203585314 Un_KI270746v1:63919-63941 CATTGAAAGAAGAATCGTCTTGG + Intergenic
1203613546 Un_KI270749v1:29762-29784 CATTGGAAGAAGAATGCTCCTGG + Intergenic
1185804742 X:3046898-3046920 CACTGGAAGAAAAATTGTCTTGG + Intronic
1186454647 X:9701503-9701525 CATTGAAAGAAGAATTGTCTTGG + Intronic
1186552795 X:10524337-10524359 TGCTGGAAGAAGAACTGTCTTGG + Intronic
1186743798 X:12545310-12545332 CACTGGAAGAAGAATTGTCTTGG - Intronic
1186775107 X:12856887-12856909 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1187013481 X:15303278-15303300 CATTGGAAGGAGTATTGTCTTGG + Intronic
1187027045 X:15446403-15446425 CACTGGAAGAAGAATTGTCTTGG + Intronic
1187043935 X:15626573-15626595 AATTTGAAGAAGAATTGTCTTGG - Intergenic
1187274832 X:17808141-17808163 CATTGGAAGAAGAATTGTCTTGG - Intronic
1187408765 X:19028594-19028616 CATTGAAAGAAGAATTGTCTTGG + Intronic
1187413555 X:19072226-19072248 CATTGGTAGAAGAATTGTCATGG - Intronic
1187457236 X:19452899-19452921 CATTGGAAGAAGAATTGTCTTGG - Intronic
1188038266 X:25342525-25342547 CAATGGAAGAAGAATTGTCTTGG + Intergenic
1188258941 X:27999617-27999639 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1188359833 X:29239781-29239803 TAGAAGAAGAAGAATTGTCTTGG - Intronic
1188472000 X:30551606-30551628 CAGAAGAAGAAGAATTGTCTTGG - Intergenic
1188538263 X:31220965-31220987 CAGTGGAAGAAGAATTGTCTTGG - Intronic
1188585483 X:31769538-31769560 CACTGGAAGAAGAATTGTCCTGG + Intronic
1188716880 X:33469541-33469563 TGGAGGAAGAAGAATTGTCTTGG - Intergenic
1188745700 X:33839914-33839936 CACTGGAAGAAGAATTGTCTTGG - Intergenic
1189075442 X:37909538-37909560 CACTGGAAGAAGAATTGTCTTGG - Intronic
1189720895 X:43916297-43916319 CACTGGAAGAAAAATTGTCTTGG - Intergenic
1189975254 X:46454917-46454939 TACTGGAAGAAGAACTGTCTTGG - Intronic
1190060385 X:47207318-47207340 CATTGGAAGAAGAATTGTCTCGG + Intronic
1190077411 X:47327897-47327919 CATTGGAAGAAGAATTGTTTTGG + Intergenic
1190149592 X:47933040-47933062 CATTGGAAGAAGAATTGTACTGG + Intronic
1190251661 X:48731577-48731599 CATTGGAAGAATAATTGTCTTGG - Intergenic
1190393304 X:49954400-49954422 CACTGGAAGAAGAATTATCTTGG - Intronic
1190780019 X:53584834-53584856 CACTGGAAGAAGAATTGTCTTGG + Intronic
1190823541 X:53996474-53996496 CCTTGGAAGAAGAATTGTCTTGG - Intronic
1192137447 X:68616881-68616903 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1192245717 X:69370039-69370061 CATTGGAAGAAGAATTGTCTTGG - Intergenic
1192482098 X:71494520-71494542 CACTGGAAGAAGAATTGTCTTGG - Intronic
1192743170 X:73913037-73913059 CATTGGAAGAAGAATTGTCTAGG + Intergenic
1193319420 X:80104171-80104193 CATTAGAAGAAGAATTGTCTTGG - Intergenic
1193414603 X:81206641-81206663 AAGTGGAAGAAGAGTTGCCTGGG + Intronic
1193418366 X:81252554-81252576 CATTGGAAAAAAAGTTGTCTTGG + Intronic
1194160238 X:90440203-90440225 CATTAGAGGAAGAATTGTCTTGG + Intergenic
1194361637 X:92958937-92958959 AACTGAAAGAAGAATTGTCTTGG + Intergenic
1194633050 X:96310398-96310420 CACTGGAAGTAGAACTGTGTTGG + Intergenic
1194649638 X:96499617-96499639 CACTGGAAGAAGAATTGTCTTGG + Intergenic
1194659087 X:96608890-96608912 AATTGAATGAAGACTTGTCTAGG + Intergenic
1195134315 X:101888783-101888805 CGTTGGAAGAAGAATTACCTTGG - Intronic
1195403275 X:104484702-104484724 CTTTGGAGGAAGAATTGGCTTGG - Intergenic
1195786367 X:108527931-108527953 CAGTGGACGGACAATTGTCTGGG - Intronic
1195893155 X:109717909-109717931 TGTTGGAAGAAGAATTGTCTTGG - Intronic
1195929451 X:110059790-110059812 CACTGGAAGAAGAATTGTCTCGG - Intronic
1195939235 X:110153828-110153850 CATGGGAAGGAGAATTGTCTTGG - Intronic
1195961068 X:110387440-110387462 CATTGGAACATGCATTCTCTGGG + Intronic
1196137863 X:112229591-112229613 CATTGGAAGAAAAATTGTTTTGG + Intergenic
1196436790 X:115681866-115681888 CATTGGAAGAAGAATTGTCATGG + Intergenic
1196648025 X:118139295-118139317 CTTTGAAAGAAGAGTTGGCTAGG - Intergenic
1196753424 X:119137735-119137757 CATTGGAAGAAGAATTGTCTTGG - Intronic
1197517134 X:127446975-127446997 CATTGGAAGAAGAATTTTCTTGG - Intergenic
1197517758 X:127457061-127457083 TATTTGAAGAAAAATTTTCTCGG - Intergenic
1197693505 X:129526787-129526809 TACTGGAAGAATAATTGTCCTGG - Intergenic
1197739399 X:129877794-129877816 CCTTGGAAGAAGAATTGTCTTGG - Intergenic
1198082124 X:133250224-133250246 CATTGGAAGAAGAATTTTCTTGG - Intergenic
1198125416 X:133638756-133638778 CACTGGAAGAAGAATTGTCTTGG + Intronic
1198250403 X:134874417-134874439 CATTGGAAGAAGAATTGTCTTGG + Intergenic
1198403063 X:136286290-136286312 CATTGGAAGAAGAACTCTCTAGG + Intergenic
1199079102 X:143556517-143556539 CATTGAAAGAAGAATTGTCTTGG + Intergenic
1199704326 X:150411038-150411060 CAGTGGAAGAAGAATTGTCCTGG - Intronic
1199825035 X:151490292-151490314 CTTTGGAAGAAGAATTGTCTTGG + Intergenic
1200506529 Y:4017151-4017173 CATTAGAGGAAGAATTGTCTTGG + Intergenic
1200669828 Y:6074811-6074833 AACTGAAAGAAGAATTGTCTTGG + Intergenic
1201276474 Y:12303451-12303473 CATTGGAAGAAAAATTGTCTCGG - Intergenic
1201366806 Y:13215903-13215925 CACTGAAAGAACAATTGTCTTGG + Intergenic
1201886442 Y:18889050-18889072 CTTTCCAAGAAGAATTATCTAGG - Intergenic