ID: 1090091747

View in Genome Browser
Species Human (GRCh38)
Location 11:123704037-123704059
Sequence ATTGGAAGAAGAATTGTCTT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2021
Summary {0: 224, 1: 429, 2: 334, 3: 297, 4: 737}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090091733_1090091747 29 Left 1090091733 11:123703985-123704007 CCTTTGAGCCCCTAGAACAGGGG No data
Right 1090091747 11:123704037-123704059 ATTGGAAGAAGAATTGTCTTGGG 0: 224
1: 429
2: 334
3: 297
4: 737
1090091731_1090091747 30 Left 1090091731 11:123703984-123704006 CCCTTTGAGCCCCTAGAACAGGG No data
Right 1090091747 11:123704037-123704059 ATTGGAAGAAGAATTGTCTTGGG 0: 224
1: 429
2: 334
3: 297
4: 737
1090091735_1090091747 21 Left 1090091735 11:123703993-123704015 CCCCTAGAACAGGGGTGTCCAAA No data
Right 1090091747 11:123704037-123704059 ATTGGAAGAAGAATTGTCTTGGG 0: 224
1: 429
2: 334
3: 297
4: 737
1090091736_1090091747 20 Left 1090091736 11:123703994-123704016 CCCTAGAACAGGGGTGTCCAAAC No data
Right 1090091747 11:123704037-123704059 ATTGGAAGAAGAATTGTCTTGGG 0: 224
1: 429
2: 334
3: 297
4: 737
1090091737_1090091747 19 Left 1090091737 11:123703995-123704017 CCTAGAACAGGGGTGTCCAAACT No data
Right 1090091747 11:123704037-123704059 ATTGGAAGAAGAATTGTCTTGGG 0: 224
1: 429
2: 334
3: 297
4: 737
1090091741_1090091747 3 Left 1090091741 11:123704011-123704033 CCAAACTTTTGGCTTCCCTGGGC 0: 24
1: 747
2: 980
3: 645
4: 513
Right 1090091747 11:123704037-123704059 ATTGGAAGAAGAATTGTCTTGGG 0: 224
1: 429
2: 334
3: 297
4: 737

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090091747 Original CRISPR ATTGGAAGAAGAATTGTCTT GGG Intergenic
Too many off-targets to display for this crispr