ID: 1090094643

View in Genome Browser
Species Human (GRCh38)
Location 11:123730580-123730602
Sequence CTGTAGTTCTCCAGGTAGGA CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 206
Summary {0: 1, 1: 0, 2: 1, 3: 14, 4: 190}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090094632_1090094643 14 Left 1090094632 11:123730543-123730565 CCTCGCCACTTTCTGGCCGTTGG 0: 1
1: 0
2: 1
3: 3
4: 83
Right 1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG 0: 1
1: 0
2: 1
3: 14
4: 190
1090094637_1090094643 -10 Left 1090094637 11:123730567-123730589 CCCGCACCCAGCTCTGTAGTTCT 0: 1
1: 0
2: 3
3: 21
4: 274
Right 1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG 0: 1
1: 0
2: 1
3: 14
4: 190
1090094634_1090094643 9 Left 1090094634 11:123730548-123730570 CCACTTTCTGGCCGTTGGCCCCG 0: 1
1: 0
2: 1
3: 1
4: 75
Right 1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG 0: 1
1: 0
2: 1
3: 14
4: 190
1090094631_1090094643 17 Left 1090094631 11:123730540-123730562 CCTCCTCGCCACTTTCTGGCCGT 0: 1
1: 0
2: 0
3: 5
4: 133
Right 1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG 0: 1
1: 0
2: 1
3: 14
4: 190
1090094635_1090094643 -2 Left 1090094635 11:123730559-123730581 CCGTTGGCCCCGCACCCAGCTCT 0: 1
1: 0
2: 4
3: 25
4: 300
Right 1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG 0: 1
1: 0
2: 1
3: 14
4: 190
1090094629_1090094643 29 Left 1090094629 11:123730528-123730550 CCAGCGTCACTGCCTCCTCGCCA 0: 1
1: 0
2: 2
3: 9
4: 269
Right 1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG 0: 1
1: 0
2: 1
3: 14
4: 190
1090094636_1090094643 -9 Left 1090094636 11:123730566-123730588 CCCCGCACCCAGCTCTGTAGTTC 0: 1
1: 0
2: 1
3: 10
4: 153
Right 1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG 0: 1
1: 0
2: 1
3: 14
4: 190

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090094643 Original CRISPR CTGTAGTTCTCCAGGTAGGA CGG Exonic
901521090 1:9785665-9785687 CAGTGGTTCTCAAGGGAGGAGGG - Intronic
905262555 1:36729919-36729941 CTGTGGTTCTCCAGGGAGCCAGG - Intergenic
905645310 1:39621254-39621276 CTGTCTCTCTCCAGGAAGGAGGG + Intergenic
906562357 1:46768535-46768557 CTGGAGAAATCCAGGTAGGAGGG - Intronic
910567288 1:88658617-88658639 CTCTAGTTCTCCTGGTCGGGTGG - Intergenic
911032855 1:93508440-93508462 CTGTAGTTTTTCAGGTTGCAGGG + Intronic
911063456 1:93767151-93767173 CAGTAGTTATCCAGGCAGGGTGG + Intronic
911550307 1:99270466-99270488 TTGAACTTCCCCAGGTAGGATGG - Intronic
914850096 1:151307896-151307918 CTGGAGTTCTCCAGATAGTGGGG - Intronic
914881024 1:151547299-151547321 CCATAGTTCTCCAGGGTGGAGGG + Intronic
915466501 1:156101601-156101623 CTGCAGTTACCCAGGAAGGAAGG + Intronic
920961828 1:210670475-210670497 CTGAAGGCCTCCAGGGAGGATGG + Intronic
921666514 1:217878967-217878989 CTCTAGTTCTGCAGGTGGCAAGG + Intergenic
1064004251 10:11687776-11687798 CAGTAGTGCTCTAGGTTGGAAGG + Intergenic
1064607150 10:17054821-17054843 CTGTAGTTTTCTTTGTAGGAAGG - Intronic
1065966391 10:30774497-30774519 CTGTGGTTCGCCTGGCAGGATGG - Intergenic
1068046584 10:51893811-51893833 CTGTAGTTACACAGCTAGGAAGG + Intronic
1068719366 10:60225712-60225734 CTGTAGTTTTCCAAGTAGAGAGG - Intronic
1069824541 10:71247002-71247024 CTGACATTCTCCAGGTAGCAGGG - Intronic
1072683447 10:97523001-97523023 CTGGAGATCTCCAGGTAGGCAGG - Intronic
1073326803 10:102647945-102647967 TTGTAGTTCCCCAGGATGGATGG - Intronic
1073646468 10:105309467-105309489 CTGTAGTTCTCCATTTATCATGG + Intergenic
1074646280 10:115456871-115456893 CTGTAGTTCAGCAAGTGGGAGGG + Intronic
1085499972 11:77011287-77011309 CTTTGGTTATCCAGGTAGCAGGG - Intronic
1085910392 11:80817915-80817937 CTGGAGAGCTCCACGTAGGATGG - Intergenic
1086070592 11:82795051-82795073 CTGATGGTCTCCAGGCAGGAGGG - Intergenic
1086401739 11:86466447-86466469 CTGTAGGTCACCAGGTTGGAAGG - Intronic
1086782854 11:90929372-90929394 CAGAAGTGCCCCAGGTAGGAGGG - Intergenic
1087135125 11:94708691-94708713 CTGTAGTTGGCATGGTAGGAAGG + Intronic
1088933735 11:114378067-114378089 CTGTAGGAGTCCTGGTAGGAGGG + Intergenic
1090094643 11:123730580-123730602 CTGTAGTTCTCCAGGTAGGACGG + Exonic
1090279717 11:125445379-125445401 CTGCAGATCTCCTGGTGGGATGG - Intergenic
1090359020 11:126160023-126160045 CAGCAGGTCACCAGGTAGGAGGG - Intergenic
1091056985 11:132428719-132428741 CTGAATTCCCCCAGGTAGGAGGG - Intronic
1093331413 12:17847199-17847221 CTGGAGATTTCTAGGTAGGAGGG + Intergenic
1093492351 12:19719507-19719529 CTGTAGATGTCCAGATAAGAAGG + Intronic
1094307372 12:29035971-29035993 CCCTAGTTCTCCAGGAAGAAAGG - Intergenic
1097185773 12:57195564-57195586 CTGTGGTTCTCCTGGTAGAGTGG - Intronic
1098399858 12:70063578-70063600 TTGTTGTTGTCCAGGTTGGACGG + Intergenic
1100235230 12:92654115-92654137 CAGAATTTCTCCAGGTAGTATGG + Intergenic
1100822523 12:98444737-98444759 CTGGGGTTAGCCAGGTAGGAAGG - Intergenic
1102582049 12:113895659-113895681 ATGAATTTCTCCAGGGAGGAGGG + Intronic
1102636792 12:114331595-114331617 CAGTTGTTCTCCAGGTAGAGGGG - Intergenic
1103325608 12:120117729-120117751 CTGCAGTTCTGCAGTGAGGATGG - Intergenic
1104072323 12:125356602-125356624 CTGTAGATGTCCAGCCAGGAGGG - Intronic
1104830290 12:131746295-131746317 CTGTAGGTCCTCAGCTAGGAAGG - Intronic
1106023312 13:25934701-25934723 CTGAGCTTCTCCAGGTAGAATGG - Intronic
1106619534 13:31360219-31360241 CTGGAGTTTCCCTGGTAGGAGGG - Intergenic
1106872225 13:34034114-34034136 CTGTAATTGTCCAGGTTCGAAGG + Intergenic
1108758933 13:53539221-53539243 CTTTAGTTCTGCAGCTAGGTTGG - Intergenic
1110237588 13:73232651-73232673 CTGTAGTCCTACAGGTGGGAAGG - Intergenic
1111153416 13:84290226-84290248 TTGTAGTTCTCCTTGTAGAAAGG - Intergenic
1112188126 13:97147690-97147712 GTGTAGGTATCCAGGAAGGATGG + Intergenic
1112385193 13:98932612-98932634 CTGAAGTTCTCCACCTAGGCTGG - Intronic
1113368444 13:109700362-109700384 CTGTAGTTAGCCAGGCAGGGAGG + Intergenic
1115442625 14:33453762-33453784 CTGTGGGTCTCCAGGTAAGGAGG - Intronic
1118748092 14:68788793-68788815 GTGTAGGTCTGCAGGAAGGAAGG - Exonic
1124034504 15:26042344-26042366 CTGTATGTTTCCAGTTAGGATGG + Intergenic
1124803803 15:32860920-32860942 GGGTAGTTCTCAAGGTAGGCAGG + Intronic
1129655830 15:77525321-77525343 CAGCAGTTCTCCTGGAAGGAGGG + Intergenic
1131446462 15:92502041-92502063 CTGAGGTTCTGCAGGGAGGAGGG - Intergenic
1131470944 15:92696484-92696506 CTTTAATTCTTCAGCTAGGATGG - Intronic
1132036546 15:98489897-98489919 CTGTTGGTCTCTAGGGAGGAGGG - Intronic
1132092414 15:98957107-98957129 CTGATGATCTCCAGGAAGGAAGG - Exonic
1132893725 16:2217536-2217558 CTGTATGTGTGCAGGTAGGAGGG + Intergenic
1136012685 16:27374312-27374334 CGGAAGTTCTGCAGGGAGGAAGG - Intergenic
1138266606 16:55664278-55664300 CTGTAGTGCTGCATGAAGGATGG - Intronic
1138453547 16:57107582-57107604 CTGCTGTCCTCCAGGCAGGAAGG - Intronic
1140918909 16:79519157-79519179 CTGTGGTTCTCCATGTACAAAGG - Intergenic
1141871309 16:86788599-86788621 CTCTAGATCTCCAGGCAGGGAGG - Intergenic
1143411573 17:6712632-6712654 ATGTGGCTCTCCAGGTTGGAAGG + Intronic
1143842799 17:9746742-9746764 CTGTAGTACTACAGGTAGCAAGG + Intergenic
1144349202 17:14378519-14378541 CTGTACTTCTCCAGTCTGGATGG - Intergenic
1144669780 17:17126472-17126494 ATGTCGCTCTCCACGTAGGAGGG + Intronic
1144778064 17:17794866-17794888 CTGTGGTTCTCCAGCGAGAAGGG - Exonic
1147443340 17:40460625-40460647 CTGGAATTGTCCAGGTAGAAGGG - Intergenic
1147569553 17:41560245-41560267 CTGTGGTTCCCCAGTTAGAATGG + Intergenic
1153176923 18:2385585-2385607 CAGTAGTTCTCCAGTCAGCAAGG - Intergenic
1153216507 18:2825790-2825812 CTGAAGTTCTCCAGGCAGCGAGG + Intergenic
1156249645 18:35340324-35340346 CTGTAGCTCTTTGGGTAGGATGG + Exonic
1157199382 18:45646243-45646265 CTGGAGTTTTCCAGGCAGGAAGG + Intronic
1157597620 18:48873434-48873456 TTCTAGTTTTCCAGGGAGGAAGG + Intergenic
1157781041 18:50439413-50439435 CTGTAGTTCTCCACCTGGGCTGG - Intergenic
1158511863 18:58097742-58097764 CTGTAGTTGACCAGGTATGGTGG + Intronic
1159158838 18:64618524-64618546 CTGTAGTTTTCCAAGTTGGCAGG + Intergenic
1159578482 18:70207603-70207625 CTGTAGTTATCCAGGAAGGAAGG + Intergenic
1160237247 18:77095673-77095695 CTGCTGTTCTCCAGGGAGGATGG + Intronic
1162107334 19:8377944-8377966 CTGTCGTTCCCCAGGTTGGAGGG - Intronic
1165151903 19:33765978-33766000 GTGAAGTTCCCCAAGTAGGAGGG + Intronic
1165638262 19:37362385-37362407 CTGTTGTTCTTCAGGTGGGCTGG - Exonic
1166534635 19:43564897-43564919 CTCTAGTGCTCCCGGAAGGAAGG - Intronic
1167228895 19:48269167-48269189 CTGGAGCTCCCCAGGAAGGAAGG - Intronic
927278890 2:21286475-21286497 CTGTAGTTGTCCAAGGAAGATGG + Intergenic
928179037 2:29054663-29054685 CTGAAGCTCTCCGGGTGGGAGGG + Exonic
929170397 2:38926685-38926707 CTGGGGTTCTGCAGGGAGGAAGG + Intronic
929582076 2:43087807-43087829 CTGTAGATCTCTAGGTATAATGG - Intergenic
936152075 2:110027508-110027530 GTGTAGTTGTCCAGGTTGAAGGG + Intergenic
936192603 2:110343905-110343927 GTGTAGTTGTCCAGGTTGAAGGG - Intergenic
939251166 2:139683387-139683409 CTGTAATTCTCCAGTTTGGGAGG + Intergenic
940338085 2:152549442-152549464 CTGTAGTTCTCCAAGTTGGTTGG + Intronic
947079583 2:226381188-226381210 CTGGGGTTCTCCAGAGAGGAAGG - Intergenic
947819761 2:233061561-233061583 TTGTGCTTCTCCAGGCAGGAGGG + Intronic
948279851 2:236738742-236738764 ATATAGTTCATCAGGTAGGAAGG + Intergenic
948554631 2:238799626-238799648 CTGGAGTTCTCACAGTAGGAGGG + Intergenic
1169459508 20:5782076-5782098 CTGGAGTTGACCAGGGAGGAGGG - Intronic
1173814064 20:45973688-45973710 CTGTTGTTCCCCAGGCTGGAAGG - Intergenic
1175804931 20:61821881-61821903 CTGTGGTTCTCCAGCCAGGTGGG + Intronic
1176075271 20:63245440-63245462 CTGCAGGTCCCCAGGCAGGAGGG - Intronic
1178496235 21:33088814-33088836 CTGTATGTCTCCAGGTCAGACGG - Intergenic
1180831514 22:18909342-18909364 CTACAGTTCCCCAGGAAGGAGGG - Intronic
1182257559 22:29049733-29049755 CTGCCGCTCTCCAGGTGGGAGGG - Exonic
1183370580 22:37429484-37429506 CTGGAGGTCTCCAGGGAGAAGGG - Intergenic
1203281598 22_KI270734v1_random:134613-134635 CTACAGTTCCCCAGGAAGGAGGG - Intergenic
949588370 3:5466127-5466149 CTCTAGTCATCCAGGTAGAAAGG - Intergenic
949915039 3:8954623-8954645 TTGTAGTTCTGCAGGTACAAAGG - Intronic
950130546 3:10542485-10542507 CTGTAGTTCTCCAAACAGAAAGG - Intronic
952586622 3:34900503-34900525 CTGAAGTCCTCCAGGTAGATGGG - Intergenic
952915461 3:38235638-38235660 CTGTAGTCTTCCAGGGAGGGGGG + Intronic
953248234 3:41216894-41216916 CTGTAGTTGTCCAGGTGAGCGGG - Intronic
953870016 3:46618274-46618296 CTGTACTTCAGCAGGTGGGATGG - Intronic
956387591 3:68737069-68737091 CTGTAGTTCTCTTGGTAGAACGG - Intronic
957893792 3:86392202-86392224 TATTATTTCTCCAGGTAGGATGG - Intergenic
959615975 3:108347680-108347702 TTGTAGATATCCAGGTAAGAAGG + Intronic
962958908 3:140291922-140291944 ATGTGGTCCTCCAGGTGGGATGG - Intronic
964899952 3:161646733-161646755 CTTTATTTAGCCAGGTAGGACGG + Intergenic
965218599 3:165897323-165897345 CTGCAGTCCTCCAGGCAGCAAGG - Intergenic
967294476 3:187951769-187951791 TTGTAGTTTTCCTGGTAGGAAGG - Intergenic
967320957 3:188194598-188194620 CTGTAGTTCTTGAGGGAAGAAGG + Intronic
968084296 3:195867635-195867657 TGGTAGCGCTCCAGGTAGGATGG + Exonic
969516464 4:7650942-7650964 CTGCATTTCTCAAGGGAGGATGG - Intronic
969660985 4:8527418-8527440 CAGGAGTGCTCCAGGTAGCAGGG + Intergenic
969695424 4:8731545-8731567 CTGAAGCCCTCCAGGGAGGAAGG + Intergenic
973060765 4:45720849-45720871 CTTTATTTCTCCATGTATGAAGG - Intergenic
973277690 4:48327163-48327185 CTGCAGGTCTCCAGGTTTGAGGG - Intergenic
974938593 4:68437162-68437184 ATTTATTTCTTCAGGTAGGAAGG - Intergenic
978886983 4:113775852-113775874 CTGTGGTCCCCCAGATAGGATGG - Intergenic
979749411 4:124259023-124259045 CTGGAGTTTTCCTTGTAGGAGGG - Intergenic
980656472 4:135793706-135793728 CTGTAGTTCGGCAAGCAGGAGGG + Intergenic
980861025 4:138499859-138499881 CTGTGGTACTATAGGTAGGATGG + Intergenic
982322760 4:154096825-154096847 TTGTAATTCTATAGGTAGGAGGG + Intergenic
982844332 4:160230905-160230927 CTGATGTTCTCTATGTAGGAAGG + Intergenic
983209058 4:164940032-164940054 GTGTGATTCTCCAGGAAGGAGGG + Intergenic
983209920 4:164948015-164948037 GTGTGATTCTCCAGGAAGGAGGG - Intergenic
986597196 5:9436311-9436333 CTGTGGTTCTCCATGGGGGAGGG + Intronic
997374705 5:133389429-133389451 CTGGAGTTCTGCAGGTGGGTGGG + Intronic
997737408 5:136224100-136224122 CTGTAATTCTCCCTGTGGGAAGG + Intronic
999258253 5:150222007-150222029 CTGGAATTCTCCAGGGATGACGG + Intronic
999376050 5:151087157-151087179 CTGTGCTTCTGCAGGAAGGAGGG + Exonic
1005675336 6:28148709-28148731 CTGGAGCTCCTCAGGTAGGATGG - Exonic
1005700719 6:28398097-28398119 CTGGAGCTCCTCAGGTAGGATGG + Exonic
1005998378 6:30946159-30946181 CTGTCCTTCTCCTGGTAGTAAGG - Intronic
1006220605 6:32487020-32487042 CTCTAGTACTCCAGATATGAAGG - Intergenic
1006226879 6:32546812-32546834 CTCTAGTACTCCAGATATGAAGG - Intergenic
1006397210 6:33795315-33795337 CAGCAGTTCTCCAGGGAGGCGGG - Intronic
1007422444 6:41727899-41727921 CTCTAGTCCTCCTGGAAGGAAGG + Intronic
1007715732 6:43855027-43855049 CTGGGGTTCTCCAGCTGGGAGGG + Intergenic
1012889144 6:104879288-104879310 CTCTAGTTGTCCAGGCTGGAGGG - Intergenic
1013149565 6:107430988-107431010 TTGCTATTCTCCAGGTAGGAAGG + Intronic
1014896547 6:126907204-126907226 CTGTATTACTGCAGCTAGGAAGG + Intergenic
1015490322 6:133817689-133817711 TTTTACTTCTCCAGGTAGGTAGG - Intergenic
1015752191 6:136571444-136571466 CTGTAGTTCAGCAAGTGGGAGGG - Intronic
1015780441 6:136860251-136860273 ATTTTGTTTTCCAGGTAGGAAGG - Intronic
1015791359 6:136967569-136967591 CTGGAGATCTCCAGGCTGGATGG - Intergenic
1017013861 6:150084280-150084302 CAGTAGTTCTAAAGGCAGGATGG + Intergenic
1018069202 6:160146955-160146977 GTGTAGTTCTCTAGGGAGAAAGG + Intronic
1019498541 7:1352717-1352739 CTGTAGCTATCCATGTAGGGAGG - Intergenic
1019577186 7:1743255-1743277 CTGAGGGTCTCCAGGCAGGACGG - Intronic
1023297388 7:38729608-38729630 TTGTCATTCTCCAGGCAGGAAGG - Intronic
1023803122 7:43852062-43852084 CTGTAGTTCAGCAAGCAGGAGGG - Intergenic
1024211118 7:47205997-47206019 CTGGAGTTTTCTATGTAGGAAGG - Intergenic
1028716159 7:93972054-93972076 ATGTTATTCTCCAGGTGGGAAGG - Intronic
1029188456 7:98755579-98755601 CTGTAGTTCAGGAGGAAGGAGGG + Intergenic
1030391636 7:108935346-108935368 CTGTAGTAATCCAAATAGGATGG + Intergenic
1030755696 7:113285448-113285470 CTGTAGTTCAGCAAGTAGGAGGG + Intergenic
1035899805 8:3447656-3447678 CTTTATTTCTCCTGGTTGGAAGG + Intronic
1036565737 8:9936428-9936450 CTGTAGTGGTCCAGGTAGCTGGG + Intergenic
1036797801 8:11768764-11768786 CTTTAGTTCTCGAAGGAGGATGG - Intergenic
1038495981 8:28003104-28003126 CTGGATTTCTCCTGGCAGGATGG + Intergenic
1042733936 8:71966846-71966868 CTGTAATAGTCCAGGCAGGAAGG - Intronic
1043693491 8:83187640-83187662 CTGTAGTTCAGCAAGTGGGAAGG - Intergenic
1048132228 8:131710570-131710592 CTGAGGATCTCCAGGTTGGATGG + Intergenic
1051976359 9:22954548-22954570 CTGAAGTTTTCATGGTAGGAAGG - Intergenic
1052751972 9:32501135-32501157 CTGTAGGTTTCCAGAGAGGATGG - Intronic
1053559776 9:39179153-39179175 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1053823887 9:41999397-41999419 CTGAAGTTCTCTAGGAAAGAAGG + Intronic
1054137340 9:61439790-61439812 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1054606685 9:67187970-67187992 CTGAAGTTCTCTAGGAAAGAAGG - Intergenic
1056066511 9:82940894-82940916 CTCTGGATCTCCAGGTAGGATGG + Intergenic
1057171153 9:92963975-92963997 GTGTAGATCTTCAGGGAGGAGGG - Intronic
1059891676 9:118811391-118811413 CTGTAGTTCAGCAAGTGGGAGGG + Intergenic
1062642584 9:137527881-137527903 CTGGAATTCTCCAGGTGGGAAGG + Intronic
1185816778 X:3163631-3163653 CTTCAGTTCTCCAGGTGGAAGGG - Intergenic
1185816857 X:3164181-3164203 CTCTAGTCCTCCAGGTGGAAGGG - Intergenic
1187562240 X:20413719-20413741 CTGTGTTTCTCCTGGAAGGATGG - Intergenic
1189624337 X:42879634-42879656 CTGTAGTTTTCAGGGTAGGGGGG + Intergenic
1193568581 X:83111833-83111855 CTGAAGTTCTCTTTGTAGGAAGG + Intergenic
1195156502 X:102128363-102128385 CTGAAGTTCTCAAGGTAACAAGG + Intergenic
1197719534 X:129735748-129735770 CTGCAGTTCTGCAGGTGGGAAGG - Intergenic
1200988619 Y:9327901-9327923 CAGTACTTCTCCAGGGAGGGAGG + Intergenic
1202119371 Y:21508291-21508313 CAGTACTTCTCCAGGGAGGGAGG - Intergenic
1202121823 Y:21531831-21531853 CAGTACTTCTCCAGGGAGGGAGG - Intronic
1202157183 Y:21897551-21897573 CAGTACTTCTCCAGGGAGGGAGG + Intronic
1202159629 Y:21921092-21921114 CAGTACTTCTCCAGGGAGGGAGG + Intergenic
1202186076 Y:22186007-22186029 CAGTACTTCTCCAGGGAGGGAGG + Intergenic
1202196735 Y:22305687-22305709 CAGTACTTCTCCAGGGAGGGAGG - Intergenic
1202205283 Y:22400389-22400411 CAGTACTTCTCCAGGGAGGGAGG - Intronic