ID: 1090099279

View in Genome Browser
Species Human (GRCh38)
Location 11:123776874-123776896
Sequence AAATGAAATTAGAATGATCT GGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090099277_1090099279 -7 Left 1090099277 11:123776858-123776880 CCATTTTTTACATAGAAAATGAA No data
Right 1090099279 11:123776874-123776896 AAATGAAATTAGAATGATCTGGG No data
1090099276_1090099279 7 Left 1090099276 11:123776844-123776866 CCTCATATTTTCAACCATTTTTT No data
Right 1090099279 11:123776874-123776896 AAATGAAATTAGAATGATCTGGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090099279 Original CRISPR AAATGAAATTAGAATGATCT GGG Intergenic
No off target data available for this crispr