ID: 1090101475

View in Genome Browser
Species Human (GRCh38)
Location 11:123801780-123801802
Sequence CTGTATTCAAAGAAGAAATT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1090101475_1090101476 1 Left 1090101475 11:123801780-123801802 CCTAATTTCTTCTTTGAATACAG No data
Right 1090101476 11:123801804-123801826 TTAGTGTCTCTGCCTATAGCAGG No data
1090101475_1090101478 21 Left 1090101475 11:123801780-123801802 CCTAATTTCTTCTTTGAATACAG No data
Right 1090101478 11:123801824-123801846 AGGAATAACAGCAGATATAGTGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1090101475 Original CRISPR CTGTATTCAAAGAAGAAATT AGG (reversed) Intergenic
No off target data available for this crispr